ID: 1006620514

View in Genome Browser
Species Human (GRCh38)
Location 6:35360777-35360799
Sequence CTCTAAAAATAAATCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006620514_1006620527 27 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620527 6:35360827-35360849 TTGGCTTGGATGCAGGGGCTGGG 0: 1
1: 0
2: 2
3: 19
4: 246
1006620514_1006620526 26 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620526 6:35360826-35360848 CTTGGCTTGGATGCAGGGGCTGG No data
1006620514_1006620520 13 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620520 6:35360813-35360835 TCTGTTCCCATTTCTTGGCTTGG 0: 1
1: 0
2: 4
3: 27
4: 291
1006620514_1006620519 8 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620519 6:35360808-35360830 CTATTTCTGTTCCCATTTCTTGG No data
1006620514_1006620523 20 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620523 6:35360820-35360842 CCATTTCTTGGCTTGGATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 197
1006620514_1006620524 21 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620524 6:35360821-35360843 CATTTCTTGGCTTGGATGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 150
1006620514_1006620528 28 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620528 6:35360828-35360850 TGGCTTGGATGCAGGGGCTGGGG No data
1006620514_1006620525 22 Left 1006620514 6:35360777-35360799 CCATCCCCGATTTATTTTTAGAG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1006620525 6:35360822-35360844 ATTTCTTGGCTTGGATGCAGGGG 0: 1
1: 0
2: 1
3: 31
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006620514 Original CRISPR CTCTAAAAATAAATCGGGGA TGG (reversed) Intronic
901446210 1:9309685-9309707 ATATAAAAATTAGTCGGGGATGG + Intronic
905058402 1:35118704-35118726 CTCAAAAAAAAAATCGAGGTTGG + Intergenic
906991118 1:50740201-50740223 GACTAAAAATAAAGCAGGGAAGG + Intronic
907040427 1:51253965-51253987 CTCTAAAAAAAAAAAAGGGAAGG + Intronic
907109439 1:51913470-51913492 CTCAAAAAAAAAAAAGGGGAGGG - Exonic
907455096 1:54570513-54570535 CTCAAAAAATAAAAAGGGCAAGG - Intronic
909438163 1:75668478-75668500 CTCAAAAAATTAACCGGGCATGG - Intergenic
911035349 1:93538420-93538442 AGCTAATAATAAATCTGGGAGGG - Intronic
912666023 1:111580438-111580460 CTCAAAAGAGAAATCGGGGCTGG + Intronic
915811351 1:158915546-158915568 ACCTAAAAATAAATCTGAGAGGG - Intergenic
916838777 1:168578162-168578184 CACTAAAAATAAATTGGCAAAGG + Intronic
917600084 1:176565396-176565418 CTCTAAAATGAAATGGGGGCTGG + Intronic
918021312 1:180694621-180694643 ATCAAAAAAAAAATTGGGGAAGG - Intronic
918507524 1:185273030-185273052 CTCAAAAAAAAAAAGGGGGAGGG + Intronic
918688256 1:187446603-187446625 TTCTGAAAATAAATGGTGGAGGG - Intergenic
920015619 1:202905805-202905827 GTCTAAAAAAAAATCGGGTTGGG - Intronic
920655489 1:207871281-207871303 CTCAAAAAAAAAATTGGGGGAGG - Intergenic
921781553 1:219171468-219171490 TTCTAATAATGAATCTGGGAAGG + Intergenic
1063485973 10:6421327-6421349 CTCAAAAAATTAATCAGGCATGG + Intergenic
1067383889 10:45800585-45800607 CTCAAAAAAAAAGTGGGGGAGGG + Intergenic
1068345909 10:55777667-55777689 TTCCAAAAATAAATCAGGGAGGG - Intergenic
1068497637 10:57805481-57805503 CTCTAAAAATAAGTAAGGCAGGG + Intergenic
1068865955 10:61896278-61896300 CTTTAAAAAAAAATCAGGTATGG + Intergenic
1070913783 10:80139672-80139694 CTCTCAAAAAAAAGTGGGGAGGG + Intronic
1072242889 10:93513943-93513965 CTCAAAAAAAAAAAAGGGGAGGG - Intronic
1072325965 10:94298950-94298972 CTTTAAACATAAACCGGGCATGG - Intronic
1074046642 10:109845448-109845470 CTTTAAAAATAACTTGTGGAGGG + Intergenic
1075017761 10:118923355-118923377 CTCGGAAAATGAATCGGGAAGGG - Intergenic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1079301220 11:19280664-19280686 CTCTAAAAAGAAAACGAGAAGGG + Intergenic
1080452278 11:32388155-32388177 CTTTAAAAGAAAATAGGGGATGG - Exonic
1082212194 11:49518710-49518732 CTCCAAAAATATATCAGGGCTGG + Intergenic
1083094520 11:60236109-60236131 GTCTAAAAATAAAAATGGGATGG - Intronic
1085478040 11:76799881-76799903 ATCTAAAAATTAACCGGGCATGG + Intergenic
1085758918 11:79224947-79224969 GTCTAAAAAAAAAAGGGGGAGGG + Intronic
1086637395 11:89105803-89105825 CTCCAAAAATATATCAGGGCTGG - Intergenic
1090718030 11:129447446-129447468 CTCTAAGAATAAATGGGGAGAGG + Intronic
1090819609 11:130329562-130329584 CTCTAAAATTAAATCAGGGCTGG - Intergenic
1091679703 12:2518310-2518332 CTTTAAAAAAAAATCAGGGCCGG + Intronic
1094044091 12:26147851-26147873 CTCTCAAAATACATGTGGGAGGG + Intronic
1097936975 12:65263590-65263612 CACAAAAAATTAGTCGGGGATGG - Intergenic
1098537618 12:71612172-71612194 CTTTAAAAAAAAATTGGGGTGGG - Intronic
1098594888 12:72260591-72260613 CTCTAAAAGTAGAACAGGGAAGG + Intronic
1100318732 12:93469629-93469651 CTCTAAAAAAAAATGTGGGTTGG + Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101382737 12:104228627-104228649 CTCTCAAAATAAAGTGGGGGCGG + Intronic
1101609812 12:106280183-106280205 CTTTAAAAATAAATGGGGTAAGG + Intronic
1102284934 12:111648315-111648337 CTCTAAAAATAAAGATGGGCTGG + Intronic
1102662980 12:114545839-114545861 CTCAAAAAAAAAATTGAGGAGGG - Intergenic
1102932908 12:116876315-116876337 CTCTAAAAGTAATTCTGGCAGGG + Intronic
1103516308 12:121510494-121510516 GTCTAAAAATAAGTCGAGGCTGG + Intronic
1106207142 13:27609807-27609829 CTCTCAAAATAAATCCTGAATGG + Intronic
1106212488 13:27663212-27663234 CTCTACTAATAAATAGGGCAGGG - Intronic
1106908379 13:34434063-34434085 CTGTAAAAATAATTCTGGAAAGG + Intergenic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1108558398 13:51619487-51619509 ATCTAAATTTAAATAGGGGATGG - Intronic
1108924724 13:55726915-55726937 CTCTAAGAATAAATCAGAAAAGG + Intergenic
1109070188 13:57755792-57755814 CCCTAAAAATAAATCTTCGAAGG + Intergenic
1112304750 13:98263834-98263856 CACTAAAAATAAATGGGAAAAGG - Intronic
1113407811 13:110057536-110057558 CTTTAAAAATAATTCGGTGAGGG - Intergenic
1113478318 13:110601359-110601381 CTCTAAAAACACACCTGGGAAGG - Intergenic
1114442299 14:22759320-22759342 GTCTAAGAATACATCAGGGATGG - Intergenic
1115194844 14:30785947-30785969 ATATAAAAATTAATCGGGCACGG + Intergenic
1115231668 14:31167168-31167190 CTCTAAAAATAAATATGGTCAGG + Intronic
1115617987 14:35114690-35114712 CTCTAAAAAAAAAGATGGGATGG + Intronic
1116852716 14:49924462-49924484 CTCCCAAAATAAATCAGGGCTGG - Intergenic
1118221824 14:63861442-63861464 CTCTTAAAATACAACGGGGTAGG - Intronic
1119300436 14:73567101-73567123 CTCTAAAAAGAAAAAGGGGATGG - Intergenic
1119906101 14:78303578-78303600 CACTGAAAATAAAGCAGGGAAGG - Intronic
1120804891 14:88736815-88736837 CTATAAAAAAAAATTAGGGAAGG - Intronic
1121829517 14:97037880-97037902 CAGAAAAAATAAATCAGGGAAGG + Intergenic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1130844840 15:87734858-87734880 CACTAAAAATAAACAGGGCAGGG - Intergenic
1134637225 16:15801658-15801680 CTCTAAAAACAGACCTGGGATGG + Intronic
1136714579 16:32267865-32267887 CTCTAATAATACATCTGGCAAGG - Intergenic
1136753308 16:32661550-32661572 CTCTAATAATACATCTGGCAAGG + Intergenic
1136814805 16:33208815-33208837 CTCTAATAATACATCTGGCAAGG - Intronic
1136821281 16:33318895-33318917 CTCTAATAATACATCTGGCAAGG - Intergenic
1136827844 16:33375434-33375456 CTCTAATAATACATCTGGCAAGG - Intergenic
1136832910 16:33474205-33474227 CTCTAATAATACATCTGGCAAGG - Intergenic
1138240041 16:55420049-55420071 CAGGAAAAATAAATCGGGTAGGG - Intronic
1139252398 16:65508801-65508823 CTCTAAAAAAAAAAAGGGGGTGG - Intergenic
1139934887 16:70562741-70562763 CCCCAAAACTAAATCAGGGAAGG + Intronic
1141422783 16:83927550-83927572 CTCTTCAAAAAAATCGGGGTTGG + Intronic
1141724382 16:85777487-85777509 CTCTTAAACTAAATCTGAGAGGG - Intronic
1202993381 16_KI270728v1_random:31789-31811 CTCTAATAATACATCTGGCAAGG - Intergenic
1203055471 16_KI270728v1_random:921904-921926 CTCTAATAATACATCTGGCAAGG + Intergenic
1143182552 17:4992708-4992730 CTCTAAAAAGAAAGAAGGGAGGG - Intronic
1146108078 17:30061574-30061596 CTCTAAAAAAAAGGTGGGGAGGG - Intronic
1147138519 17:38448799-38448821 ATTTAAAAATTAATCGGGGATGG - Intronic
1149642072 17:58209457-58209479 TACTAAAAACAAAACGGGGAAGG + Intronic
1150632977 17:66893270-66893292 ATCCAAAGATAAATGGGGGAAGG + Intergenic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1153699555 18:7678633-7678655 CTGTAAAAATAAAACAGGGGTGG - Intronic
1153806605 18:8713940-8713962 CTCTTTAAAAAAAGCGGGGAAGG + Intronic
1154986466 18:21555957-21555979 CTCAAAAAATAAAACAGGGTGGG + Intronic
1155010728 18:21775238-21775260 CTCTAAAAATAAATAAGGCCAGG - Intronic
1156032133 18:32725013-32725035 CTCTAAAAAAAAAAAGGGAAGGG - Intronic
1156876303 18:42017284-42017306 CTCCAAGAATAAAACGAGGAAGG - Intronic
1157263064 18:46193287-46193309 CTCTAAAAAAAAAGCAGGGGTGG - Intronic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158657370 18:59350789-59350811 CTTTAAAAAAAAATTGGGGCCGG - Intronic
1162224832 19:9212169-9212191 CTCTAAAGATAAATAGTTGAGGG - Intergenic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1163511561 19:17738592-17738614 CTCAAAAAATAAAAGGGGGAGGG + Intergenic
1165818243 19:38656852-38656874 CTCTCAAAAGACATCAGGGAGGG - Intronic
1166370565 19:42298194-42298216 CTCAAAAAATAAATAGGCCAAGG + Intronic
1166786921 19:45373151-45373173 CTCCAAAAATACAGCCGGGAAGG - Intergenic
1168447825 19:56437398-56437420 CTATAAAAATAAAATGGGGCTGG - Intergenic
925671635 2:6316163-6316185 TTCTAAGAAAAAATAGGGGAAGG - Intergenic
927115769 2:19900929-19900951 CTCAACAAATAAAGAGGGGAAGG + Intronic
928365161 2:30694754-30694776 CTTTCAAAAAAAATCTGGGAAGG - Intergenic
929461225 2:42102979-42103001 CTCTAAAAATACCAGGGGGAGGG - Intergenic
930392679 2:50782128-50782150 CTCTAATAATAAATGGGTTAAGG + Intronic
930650709 2:53961671-53961693 GTCTAAAAATAAGGGGGGGAAGG + Intronic
931498215 2:62835464-62835486 CATTAAAAATAAAGCGGGGGAGG + Intronic
931837615 2:66115502-66115524 CTTTAAAAATAATTCAGAGAGGG - Intergenic
936170764 2:110170978-110171000 CCCTAAAAATGAGTAGGGGAAGG + Intronic
938623824 2:133086484-133086506 CTTTAAAAATTAACCGGGCATGG + Intronic
940099002 2:150011952-150011974 TACTAAAAATAAGTCGGTGAAGG - Intergenic
940655547 2:156484133-156484155 CTCAAAAAAAAAGTCGGGGAGGG - Intronic
941020104 2:160398640-160398662 CTATTAAAATAAATTGGAGAGGG - Intronic
942051171 2:172142356-172142378 CAATGAAAATAAATCAGGGAAGG - Intergenic
942877121 2:180814321-180814343 CTTTAAAAAGAAATAGGGGCCGG + Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944023861 2:195140665-195140687 CTTTAAAAATAAATCTGGATGGG - Intergenic
944572672 2:201060040-201060062 GTCTAAAAAAAAAGCGGGGGGGG + Intronic
944576938 2:201099059-201099081 CTCAAAAAAAAAGTGGGGGAGGG - Intergenic
945304801 2:208249047-208249069 CTTTAAAAATAAAAGGGGGTGGG + Intronic
946224442 2:218256405-218256427 CTATAAAAATAAATCTGGCTGGG + Intergenic
947066883 2:226236977-226236999 CTATAAAAATTAACCGGGCATGG + Intergenic
1169507470 20:6227513-6227535 TTTTAAAAATAAATGGTGGAGGG + Intergenic
1171425493 20:25046235-25046257 CTCTAAAAATAAACAGGGGCCGG - Intronic
1174145327 20:48449230-48449252 CTTTAAAACTAAGTGGGGGAAGG + Intergenic
1174372860 20:50104725-50104747 CTCTAAAAATAAATTAGAAATGG - Intronic
1175020646 20:55845119-55845141 CTCTAAAAATTCATTTGGGAAGG - Intergenic
1181426153 22:22841288-22841310 TTCTAAAAATAAATCAGAAAAGG + Intronic
1182256165 22:29040178-29040200 CTCAAAAAAAAAAAGGGGGAGGG - Intronic
949722815 3:7010453-7010475 CTCTAAAAAGAAAAGTGGGAGGG + Intronic
951988379 3:28646906-28646928 AGCTCAAAATAAATCGGGTATGG + Intergenic
953843532 3:46408709-46408731 ATGTAAAAATAAATAGGGGGAGG - Exonic
955428145 3:58814102-58814124 CTCTAAAAATAAATAGGCAGAGG - Intronic
956803292 3:72783339-72783361 GTATAAAAATAAATTGGGCAAGG - Intronic
957041155 3:75336520-75336542 CTCTGAGAATATATCGGAGATGG - Intergenic
957640912 3:82852137-82852159 CTGTAAAAAAAAATAGGGCAGGG + Intergenic
959211632 3:103390945-103390967 TTCTAAAAATAAAAAGGGGGCGG - Intergenic
960601664 3:119464751-119464773 GTAAAAAAATAAATCGGGCATGG + Intronic
961848652 3:129792504-129792526 ATATAAAAATAAACCGGGCATGG - Intronic
962015544 3:131436181-131436203 CTCAAAAAATAAGTGGAGGAAGG + Intergenic
963976212 3:151483288-151483310 TTCAAAACATAAATAGGGGAAGG + Intergenic
966163171 3:176989176-176989198 TTCAAAAAATTAATCGGGCATGG + Intergenic
966335806 3:178866730-178866752 ATCTATAAATACATGGGGGAAGG + Intergenic
967337959 3:188365215-188365237 CATTAAAAATAAATCTGGGTAGG + Intronic
970163439 4:13211957-13211979 TCCTAAAAATAAATCTGGGTTGG + Intergenic
971769237 4:30874980-30875002 CTGTAACAATAAATGGGTGAAGG - Intronic
972609011 4:40639967-40639989 CTCTACAAATTAGTCGGGCATGG + Intergenic
973136854 4:46719461-46719483 CTCTAAAAATAAACCTGTTAAGG - Intergenic
975174186 4:71268653-71268675 CTTTAAAAATAAATCAGAAAAGG + Intronic
975783863 4:77867143-77867165 CAATAAAAATAATTGGGGGATGG - Intronic
976014124 4:80529336-80529358 TTCTAAAAATAAACCAAGGAAGG - Intronic
976228354 4:82814859-82814881 CTCTCAAAAGAAGTGGGGGAGGG - Intergenic
976494829 4:85715766-85715788 ATCCAAAAATTACTCGGGGAAGG - Intronic
976751496 4:88454957-88454979 CTCTAACAATGAAACGGGAAAGG - Intergenic
979442714 4:120770323-120770345 ATTTAAAAATAAATAGGGGTCGG - Intronic
979946198 4:126834525-126834547 CTAAATAAATAAATCGGAGATGG + Intergenic
980034715 4:127870789-127870811 TTCTGAAAATAAAGCAGGGAAGG + Intergenic
980735381 4:136879248-136879270 CACTAAAAATAAATATGTGAGGG + Intergenic
982157046 4:152534253-152534275 CTCTAAAAAAAAAAAGGGGGGGG + Intronic
982581888 4:157189194-157189216 CTCAAAAAAAAAAATGGGGAGGG - Intergenic
983070226 4:163259259-163259281 CTCTCAAAACAAAAAGGGGAAGG - Intergenic
985042016 4:185900125-185900147 CTCTAAAAATAAAAAGAAGAAGG + Intronic
985318335 4:188681643-188681665 TTTTAAAAATTAATCGGGCATGG + Intergenic
986050761 5:4088123-4088145 CTCTAAAAATAAGGAGCGGAAGG + Intergenic
986668683 5:10125134-10125156 CTCAAAAAGAAAATTGGGGAAGG + Intergenic
988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG + Exonic
991123047 5:63038492-63038514 CTCTAAAAAAGAAAAGGGGAAGG - Intergenic
992237321 5:74724333-74724355 CTTTAAAAATTACTTGGGGATGG + Intronic
992315523 5:75549833-75549855 CTCCAAAAATCAGTAGGGGAAGG - Intronic
993401305 5:87455959-87455981 CTGAAAAAAAAAATAGGGGAAGG + Intergenic
993601590 5:89932630-89932652 GTCTAAAAAGAAATCTGGGGTGG + Intergenic
994919265 5:106021409-106021431 CCCTAAAAATAAATTGGGCTGGG + Intergenic
997257261 5:132438613-132438635 TTCTAAAAAGACATCTGGGAAGG - Intronic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997444068 5:133928602-133928624 CTCAAAAAAAAAAAGGGGGAGGG + Intergenic
1000479013 5:161747810-161747832 TTCTAAAAAAAAAGCGGGGGGGG + Intergenic
1001098329 5:168793786-168793808 CTTTAAAAATGAATTGGGGGGGG + Intronic
1001658753 5:173374646-173374668 CTCAATAAATAAATTGGGGCTGG + Intergenic
1002776828 6:335461-335483 CTCTAGAAATAAAACCGTGAAGG + Intronic
1003807350 6:9740291-9740313 TTCTAAAAATTAAAAGGGGAAGG + Intronic
1004934006 6:20489962-20489984 CTCAAAAATTAAAAGGGGGACGG + Intronic
1005055039 6:21721151-21721173 CTTTAATAATAAAAGGGGGAGGG - Intergenic
1005521098 6:26601479-26601501 CTCAAAAAATAAAAGGGGGGTGG - Intergenic
1006620514 6:35360777-35360799 CTCTAAAAATAAATCGGGGATGG - Intronic
1007430948 6:41776621-41776643 CTCTAAAAAAAAAAGGGGGGGGG + Intronic
1008772860 6:55000697-55000719 CTCTAAAAATAAATTGCGATGGG - Intergenic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1013470111 6:110456578-110456600 CTCCAAACATAAATAGGGGCTGG + Exonic
1014883302 6:126748592-126748614 CCCTTAAAAGAAATGGGGGAAGG - Intergenic
1017147403 6:151247086-151247108 CTTTAAAAATTAATTGGGCAGGG - Intronic
1018399791 6:163411493-163411515 TTCTAAAGATAAATAGGGGCAGG + Intergenic
1018848002 6:167568429-167568451 CACTGAAAATAAATCTGGGCTGG - Intergenic
1020183879 7:5943841-5943863 CTCAAAATATAAATCTGGGCTGG - Intronic
1020299038 7:6780936-6780958 CTCAAAATATAAATCTGGGCTGG + Intronic
1020426356 7:8070453-8070475 CTCTAAAAATTAAACTAGGAAGG + Intronic
1020834980 7:13137990-13138012 CTCTAAAAATGGAGAGGGGAAGG - Intergenic
1023886808 7:44363395-44363417 ATTTAAAAATAAATCGGGCTGGG + Intergenic
1027810152 7:82886008-82886030 CTCTAAAACTGAATGGGGAAAGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032651993 7:133889101-133889123 CTTTTAAAATAAATCATGGAAGG + Intronic
1034758940 7:153652869-153652891 CTCTAAAAATAGGTGGGGAATGG - Intergenic
1037072448 8:14668254-14668276 ATTTAAAAATAAATCTGGGCTGG - Intronic
1040122881 8:43701943-43701965 CTCTACAAATAATCCGGTGAAGG - Intergenic
1044147716 8:88738489-88738511 CTCAAAAAAAAAATGGGGGGGGG - Intergenic
1045138088 8:99245838-99245860 CTCAAAAAATAAATCAGGGCTGG - Intronic
1046705053 8:117440464-117440486 CTAGAAATATAAATCTGGGATGG - Intergenic
1048062921 8:130938819-130938841 CCCTAAAAATAATCCTGGGATGG - Intronic
1049018593 8:139938939-139938961 CTTAAAAAATTAATCGGGGCCGG - Intronic
1053552655 9:39100629-39100651 CTCTAAAAATAAAGTGTGAAAGG + Intronic
1053816771 9:41920793-41920815 CTCTAAAAATAAAGTGTGAAAGG + Intronic
1054107031 9:61064475-61064497 CTCTAAAAATAAAGTGTGAAAGG + Intergenic
1054613826 9:67266650-67266672 CTCTAAAAATAAAGTGTGAAAGG - Intergenic
1055183790 9:73425028-73425050 CTCTGAAAATAAATCAAGGCTGG - Intergenic
1055482897 9:76727362-76727384 CTAGAAAAGTAAATCAGGGATGG + Intronic
1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG + Intergenic
1058340989 9:103896121-103896143 GTGAAAAAATAAATAGGGGAGGG + Intergenic
1059811218 9:117857747-117857769 CTCTACAAAGAAATTGGAGAGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191604586 X:63046458-63046480 CACAAAAAATAATTCAGGGATGG + Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1196222927 X:113133284-113133306 TTCTAAAAATAAATCTCTGAAGG - Intergenic
1196393159 X:115231041-115231063 ATTTCAAAATAAATGGGGGAAGG - Intronic
1197056715 X:122129431-122129453 CTCTGAAAATAAATTTGGAAAGG + Intergenic
1198651737 X:138870669-138870691 CTCTTAAAATAAAATGAGGAAGG + Intronic