ID: 1006620900

View in Genome Browser
Species Human (GRCh38)
Location 6:35363251-35363273
Sequence GCCTGCACACAGGTTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006620900 Original CRISPR GCCTGCACACAGGTTGGGCT AGG Intronic
900129206 1:1080474-1080496 GGCTGCTCAGAGGGTGGGCTGGG + Intergenic
900145241 1:1156376-1156398 GGCTGCCCACAGGCTGGGCTGGG + Intergenic
900145259 1:1156448-1156470 GGCTGCCCACAGGCTGGGCTGGG + Intergenic
901279027 1:8017759-8017781 GCTTGCAGACAGGTGGGGGTTGG - Intronic
903893063 1:26583012-26583034 GCCTGCACTTAGGATGGGCCTGG + Intergenic
905825400 1:41022631-41022653 GGCAGCAGCCAGGTTGGGCTCGG + Exonic
906644547 1:47464539-47464561 GCGTGCACTCAGGCTGAGCTGGG + Intergenic
907372081 1:54010253-54010275 GTCTGGGCACAGGCTGGGCTGGG - Intronic
908475032 1:64479010-64479032 GCCTGCAGACATGTTTGGTTTGG - Intronic
910930622 1:92439653-92439675 TCCTGGACACAAGCTGGGCTGGG + Intergenic
913414404 1:118589406-118589428 GGCTGCACACAGGTTCAGCATGG + Intergenic
915545864 1:156597368-156597390 TCCTCCACAAAGGTTGGGGTGGG + Intronic
916835616 1:168541962-168541984 GCCTCCTCAGAAGTTGGGCTGGG - Intronic
920056858 1:203199206-203199228 CCCTGCACTCAGGTTTGCCTTGG - Intergenic
921372125 1:214434775-214434797 GGCTGCACACAGGGTGGGAGAGG + Intronic
922620223 1:226984246-226984268 GCCAGCAGACAGGTGGGGCCAGG + Intronic
924165079 1:241272560-241272582 GCCTGGATACAGATGGGGCTAGG - Intronic
1066057479 10:31695510-31695532 ACCTGCCCACAGGTTGATCTTGG - Intergenic
1070310887 10:75273045-75273067 GCCTGGACACAGTTTCGGCTGGG + Intergenic
1070590010 10:77794795-77794817 GCCTTGTCACAGGTGGGGCTGGG - Intronic
1076364575 10:129913796-129913818 CCCTGCACACAGGCAGGACTCGG + Intronic
1077147133 11:1051341-1051363 GGCTGCAGACGGCTTGGGCTGGG + Intergenic
1077226390 11:1440684-1440706 GCCTGCAGAGAGGCTGGGCCAGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083043447 11:59710726-59710748 GCCTCCACATAGCCTGGGCTAGG - Intergenic
1084013216 11:66364095-66364117 GCCTGCAGACAGCTAGGGTTGGG + Intronic
1084045119 11:66563862-66563884 GCCTGGACACATGTCAGGCTGGG + Exonic
1084396348 11:68913313-68913335 GCGTGCACACAGGTGTGTCTTGG - Intronic
1084776340 11:71379284-71379306 GCATGGATACAGGCTGGGCTGGG + Intergenic
1091187937 11:133663305-133663327 GTCTGCAGAGAGGCTGGGCTGGG - Intergenic
1091803087 12:3337219-3337241 GAAGGCACACAGGCTGGGCTGGG + Intergenic
1094545572 12:31401541-31401563 GCCTGTACACAGGTTGATCTTGG - Intronic
1096609918 12:52794388-52794410 GCCTTCACTCAGGTAGGACTAGG + Intronic
1097053993 12:56239302-56239324 GCCTTGACCCAGGTTGGGCAAGG - Exonic
1097186326 12:57198387-57198409 GCCTGCAGGGAGGCTGGGCTTGG - Intronic
1099290936 12:80775728-80775750 TCCTTCACATGGGTTGGGCTGGG + Intergenic
1102577777 12:113867378-113867400 GCCTGCACAGAGGATATGCTTGG - Intronic
1103561620 12:121795921-121795943 GCCTGGACCCAGGCCGGGCTGGG - Intronic
1104193231 12:126504010-126504032 GCCTGCACACTGGCTGGCCCTGG - Intergenic
1104356961 12:128095394-128095416 AGCTTCACACAGGTTGGTCTAGG + Intergenic
1104933704 12:132353589-132353611 GCGTGCACACAGGCTTGGCGGGG - Intergenic
1104960403 12:132486008-132486030 GCCGGCTCACAGATGGGGCTGGG + Intergenic
1105216008 13:18285805-18285827 GCCTGCAGACAGGTAAGGCAGGG - Intergenic
1112563198 13:100532054-100532076 GCCTTCACCCAGCATGGGCTGGG + Exonic
1112905274 13:104410698-104410720 GCCTGCAGACCAGCTGGGCTTGG + Intergenic
1114569891 14:23659395-23659417 TCCTGCAATCAGGCTGGGCTAGG - Intergenic
1115484882 14:33901119-33901141 GCCTGCTCCCAGGCTGGGCACGG + Intergenic
1117094409 14:52282670-52282692 GCTGGCACACATGTTGGTCTCGG + Intergenic
1117831465 14:59755523-59755545 GCCTGCACAGAGGTTAGGCTGGG + Intronic
1119208059 14:72809465-72809487 GCCTGCACATAAGTTGGGAGAGG - Intronic
1121125895 14:91406559-91406581 GCCCGCACGCAGGCTGGGTTAGG + Intronic
1121316273 14:92962717-92962739 GCCTGCCCTCAGGTGGAGCTGGG + Intronic
1121492676 14:94371400-94371422 GCCTGCACTCAGGCCGGGGTGGG + Intergenic
1122422922 14:101588728-101588750 TCCTGCACACAGGGTAGGCACGG + Intergenic
1122552219 14:102556259-102556281 GCCTGCTCCCAGCTTGGGCTGGG + Intergenic
1123808333 15:23897713-23897735 GCGTCCACACCGGATGGGCTGGG + Intergenic
1124016051 15:25876917-25876939 GCCTGCAGACAGGCTGGAATTGG - Intergenic
1124231131 15:27947319-27947341 GCCAGCGCCCAGGCTGGGCTTGG + Intronic
1125014581 15:34919605-34919627 TCCTGAAAACAGGTTGGGCACGG + Intronic
1126436692 15:48645028-48645050 GGCGGCGCACGGGTTGGGCTTGG - Intronic
1128138552 15:65282536-65282558 GACTGCTCACAGGTGGGGCCTGG - Intronic
1129249957 15:74303303-74303325 CCCTGCTCCCAGGCTGGGCTTGG - Intronic
1129659370 15:77544408-77544430 GTCTGGTCACAGATTGGGCTCGG + Intergenic
1129694978 15:77735360-77735382 CGCTGCACACAGGTTTGGATAGG - Intronic
1130117050 15:81014436-81014458 GCTGGAACAGAGGTTGGGCTGGG - Intronic
1130649300 15:85752911-85752933 GCCAGCACAGAGCTTGGGCGTGG - Intergenic
1131058024 15:89387625-89387647 GCATGCACAGAGGCTGGCCTTGG + Intergenic
1131150237 15:90043122-90043144 GCCTGCACACAGGAGGTGCTCGG - Intronic
1134021323 16:10923407-10923429 GGCGGGACACAGGTGGGGCTAGG + Intronic
1135344178 16:21674085-21674107 ACCTGTACACAGGCTGGGCATGG - Intergenic
1135509837 16:23072880-23072902 GGCTGTACACTGGGTGGGCTTGG + Intronic
1135806513 16:25547578-25547600 TCCTGCACACGGGATGGGGTGGG - Intergenic
1138118926 16:54382523-54382545 GCCTGAACACAGGTGGAGTTTGG - Intergenic
1139245195 16:65434986-65435008 GACTGGACACAAGCTGGGCTGGG - Intergenic
1140939504 16:79708192-79708214 GGTGGCACACAGGTGGGGCTGGG - Intergenic
1141592188 16:85076703-85076725 GCCTGCCCACTGGTGAGGCTGGG - Intronic
1141836854 16:86546356-86546378 TGCTGTACACATGTTGGGCTGGG + Intronic
1141999869 16:87658134-87658156 CCCTGCACCCAGGTTGGTGTTGG - Intronic
1142483273 17:231375-231397 GCCTGCACACAGGAAGGGGCAGG - Intronic
1142618592 17:1151404-1151426 TCCTGCACCCAGGCTAGGCTTGG + Intronic
1142978539 17:3658861-3658883 GCCTGCACAGAGGCTGGGGCGGG + Intronic
1143411561 17:6712588-6712610 GGCTGCAGGCAGGTTGGGGTTGG - Intronic
1144070375 17:11666274-11666296 GCCTGCACCCAAGTATGGCTGGG - Intronic
1144167587 17:12627269-12627291 GCCAGCACAGAGGTGTGGCTTGG - Intergenic
1145115451 17:20206056-20206078 GATTGCACACAGGTTGGGATTGG + Intronic
1146006334 17:29162990-29163012 TCCTGCACACAGATGGGGCCAGG - Intronic
1146157232 17:30534892-30534914 ACGTTCACACAGGTTGGCCTGGG - Intergenic
1146546203 17:33741010-33741032 GTCTGCACACAGGGCTGGCTAGG - Intronic
1147177002 17:38662155-38662177 GCCTGGAGACAGGCTGGGCACGG - Intergenic
1147287650 17:39415381-39415403 GACTTCACACAGGCTGGGCACGG + Intronic
1147793248 17:43025844-43025866 CCCTGGACACAAGTTGGTCTGGG - Intronic
1148777267 17:50102586-50102608 GCCCGCACACAGGCAGTGCTAGG - Intronic
1150658465 17:67055965-67055987 CCATGCACACAGGCTGGGATGGG + Intronic
1151539758 17:74758931-74758953 GCCTCCACCCAGGCTGGGATGGG + Intronic
1152901479 17:82943523-82943545 GCCTGCTCTCAGGTGGGGATGGG + Intronic
1153258707 18:3199549-3199571 ACCTGCACACCGGCTGGGCACGG + Intronic
1155074166 18:22340659-22340681 ATCTGCACACAGGATGGGCCTGG - Intergenic
1158939610 18:62394995-62395017 GCCTGCACACTGGTGAGGGTGGG - Intergenic
1160517261 18:79485485-79485507 GCCGGCACAAAGGCTGGGGTGGG + Intronic
1160829405 19:1096035-1096057 GCCTGCACACAGGAAGTGTTGGG - Intergenic
1161159622 19:2754751-2754773 CCCTGCACCCCGGGTGGGCTTGG + Exonic
1162461675 19:10817422-10817444 GTCTGCACATTGGTTAGGCTGGG - Intronic
1162931640 19:13960569-13960591 CGCTGCACAAAGGTGGGGCTCGG + Exonic
1164849127 19:31465947-31465969 GCCTCCACAAAGGCTGGGCATGG + Intergenic
1165908000 19:39205253-39205275 GAGTGCACACAGGTTGGGCGCGG + Intergenic
1167505115 19:49867195-49867217 GCCGGCACCCAGGATGGGCGAGG - Exonic
1167718043 19:51156859-51156881 GCCTGCAGCCAGGTTGGTCTGGG - Intergenic
925977263 2:9150050-9150072 GCCTGCCCACAGGGTGCTCTAGG - Intergenic
925989451 2:9242319-9242341 GCCAGCACACTGGTGGTGCTTGG + Intronic
926064296 2:9824649-9824671 ACTTGCACACAGGTTGTTCTAGG + Intergenic
926221921 2:10942077-10942099 AAATGCACACAGGTTGGGCGCGG - Intergenic
926273419 2:11385414-11385436 GCCTGCTCACACCTTGGTCTTGG - Intergenic
927040522 2:19226163-19226185 GACTGCATGCAAGTTGGGCTGGG + Intergenic
927597027 2:24405840-24405862 GCCACCACACAGGCTGGGCGCGG - Intergenic
929943077 2:46349513-46349535 GCCTGCCCTCTGGCTGGGCTCGG + Intronic
930717682 2:54608122-54608144 GCCAGCAGACAGACTGGGCTTGG - Intronic
932274528 2:70442219-70442241 GCCTGCTGACAGATTGTGCTGGG + Intergenic
933184314 2:79261619-79261641 GCCTGCACACAGAGAGGGCAAGG + Intronic
934298319 2:91760921-91760943 GCCTGCAGACAGGTAAGGCAGGG + Intergenic
935616344 2:105086838-105086860 GCCTGCTGACAGGCTGTGCTGGG + Intronic
936926482 2:117742061-117742083 GCCTGCTTCCAGGTTGGGATGGG - Intergenic
937324012 2:120978314-120978336 GTCTGCACACAGGTCGGGGAGGG + Intronic
937911830 2:127079412-127079434 GCCTTCACACAGGTGGGGGATGG + Intronic
937992257 2:127671139-127671161 GCCTGCATGCAGGCTGGGCACGG + Intronic
939134917 2:138282313-138282335 GCCTGCAAACAGGTATGGCATGG - Intergenic
942444687 2:176070276-176070298 GGCAGCACAGAGGTTGGGCAGGG - Intergenic
942668584 2:178349267-178349289 ATCTGCACAAAGGTTGGGGTTGG - Exonic
944883350 2:204038368-204038390 GCCTGCACACAAGGATGGCTAGG + Intergenic
946174104 2:217912198-217912220 GCCTGCAAGGAGGGTGGGCTGGG + Intronic
946276187 2:218633609-218633631 GGCTGGACACAAGATGGGCTTGG - Exonic
946339015 2:219056705-219056727 GCCGGCAGCCAGGTGGGGCTTGG + Intronic
947506863 2:230713747-230713769 GCCTGCACGCAGTCTGCGCTTGG - Intronic
948197581 2:236106968-236106990 GCCTCCGCACAGGATGGCCTTGG - Intronic
948689210 2:239691400-239691422 ACCTGCACACAGGCTGGGCTGGG + Intergenic
948873206 2:240813883-240813905 GCGTGGACAGAGGTTGTGCTCGG - Intronic
948948875 2:241236236-241236258 GACTGCACACAAGGTGAGCTAGG + Intronic
1170172811 20:13434402-13434424 GCCTTCACAGAGGGTGGGCTGGG + Intronic
1170307961 20:14960358-14960380 GTCTGCACACAGGATGGTGTGGG - Intronic
1170308291 20:14964280-14964302 GACTGCACACAGGCCGGGCGCGG + Intronic
1171204459 20:23267985-23268007 GCCTGCAGATAGGATGGGATGGG + Intergenic
1172106930 20:32522585-32522607 GGCTGCACACAGGATGGGCAGGG - Intronic
1172107032 20:32523007-32523029 GGCTGCACACAGGATGGGCAGGG + Intronic
1172107911 20:32527677-32527699 GGCTCCGCACATGTTGGGCTTGG - Intronic
1172771347 20:37384329-37384351 GCCTCCGAACAGCTTGGGCTCGG - Exonic
1173250997 20:41364226-41364248 CCCTGCCCACAGGGAGGGCTGGG - Intronic
1173824391 20:46038099-46038121 GCCTGCACAGAGTAGGGGCTTGG - Intronic
1174400841 20:50275059-50275081 GGCTGCAGACAGGATGGGCAAGG - Intergenic
1174425216 20:50427443-50427465 GCCTGCAGGAAGGTTGGGCGAGG + Intergenic
1175195679 20:57241736-57241758 GCCTGCACAGATGTTGGGGTAGG + Intronic
1176184387 20:63770270-63770292 GGCTGCCCACAAGTTGTGCTGGG - Intronic
1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG + Intergenic
1179086969 21:38226682-38226704 GCCTGCACACAGCTTGGGTGAGG + Intronic
1179157136 21:38860308-38860330 GGGTGCACACAGCTTGGTCTAGG + Intergenic
1179512842 21:41885182-41885204 GCCTGCACACGGGCTTGGGTGGG - Exonic
1179580185 21:42338572-42338594 GCCTCCAGACAGGCTGGGCAAGG - Intergenic
1179949649 21:44702621-44702643 GCCTGCACACAGGGTGGCAGAGG - Intronic
1180222922 21:46370614-46370636 ATCTGCACACGGGCTGGGCTTGG + Intronic
1180965158 22:19784396-19784418 CCCTGCAGGCAGATTGGGCTTGG - Exonic
1181039914 22:20187159-20187181 GTCTGCACACAGCAGGGGCTGGG + Intergenic
1181044187 22:20206876-20206898 CCCTGAACACAGGCTGGGCCTGG - Intergenic
1181557726 22:23681459-23681481 GCATGGACACAGGTTGTGGTTGG + Intergenic
1183630095 22:39027495-39027517 GCCTGCACTCAGATGGGCCTGGG + Intronic
1185419878 22:50729305-50729327 GACAGCACAGAGGTTGGGGTGGG + Intergenic
950702073 3:14757663-14757685 CCCTGCATCCAGGTTGGTCTGGG + Exonic
953410286 3:42687032-42687054 CCCTGCACAGGGGTTGGGGTGGG + Intronic
954145416 3:48632034-48632056 GCCGCCCCACAGGTGGGGCTGGG - Exonic
955194266 3:56790559-56790581 GACTTCACACAGGTTGGGGAGGG - Intronic
958890182 3:99774590-99774612 CCCAACACACATGTTGGGCTTGG - Intronic
960628433 3:119703392-119703414 GGCCGCACTCAGGTTGGGGTCGG + Intronic
960973315 3:123154427-123154449 GGCTGCTCACAGTCTGGGCTGGG + Intronic
963274675 3:143318046-143318068 GCCTCCAAACAGATTGGGATGGG - Intronic
967865543 3:194187073-194187095 CCCTGCACACAGGCGGAGCTGGG + Intergenic
967939646 3:194756193-194756215 GCCTGGAGACAGGGTGGCCTTGG - Intergenic
968511132 4:996416-996438 GCCTGCATGCAGGGTGGGGTGGG + Intronic
969027702 4:4186939-4186961 ACATGCACACAGGCTGGGCGTGG - Intergenic
969091694 4:4698742-4698764 CCCTCCACACAGGTGGAGCTGGG + Intergenic
976657088 4:87500081-87500103 GCCTGCAGATAGGTTTGGTTTGG + Intronic
977220385 4:94331514-94331536 GCTTGCCAACAGATTGGGCTGGG + Intronic
979527216 4:121729793-121729815 ACATGGACACAGGTTGGGCGTGG - Intergenic
984873777 4:184349811-184349833 TCCTGGACTCAGGTTGGCCTTGG - Intergenic
985578636 5:685289-685311 GACTGCACTCAGCCTGGGCTTGG - Intronic
985958598 5:3282680-3282702 GCCTGCAGACAGCTGGGCCTTGG + Intergenic
986013465 5:3737727-3737749 GCTTGCACACACGATGGGATGGG + Intergenic
987999697 5:25331848-25331870 CACTGCACACAGGTTGCGATGGG - Intergenic
992067480 5:73120805-73120827 GCAGGGACGCAGGTTGGGCTCGG - Intronic
994611887 5:102052402-102052424 ACGTGCACACAGGTAGGGGTGGG + Intergenic
995187938 5:109290781-109290803 GCCTGCTCACAGGGTAGTCTTGG + Intergenic
999235321 5:150087281-150087303 TCCTGTATACAGGTTGGTCTGGG + Intronic
1001294569 5:170489882-170489904 GCCTGCAGGCATGTGGGGCTTGG - Intronic
1002300632 5:178255649-178255671 GCCTGCACAAGGGATAGGCTCGG - Intronic
1003103238 6:3193577-3193599 GCCTGCAGACAGCGTGTGCTTGG + Intergenic
1003563781 6:7205218-7205240 GCCTGCAGACTGGTAGCGCTGGG - Intronic
1004522793 6:16378077-16378099 ACCTGCACACAGGTTGTGGTGGG - Intronic
1005971141 6:30762852-30762874 GACTGAACACAGGCTGGGCACGG + Intergenic
1006620900 6:35363251-35363273 GCCTGCACACAGGTTGGGCTAGG + Intronic
1008516171 6:52321170-52321192 GCCAGAACACAGATGGGGCTGGG + Intergenic
1012744125 6:103061817-103061839 GCATGGACACAGGATGGACTGGG + Intergenic
1017160910 6:151365361-151365383 GCCTTTACAGAGGTGGGGCTGGG + Exonic
1018433604 6:163742563-163742585 CCCTGCACACTGGGTGGGGTGGG + Intergenic
1019070491 6:169341102-169341124 TCCTACACCCAGGTTGTGCTAGG + Intergenic
1019385106 7:750702-750724 GCCTGGACACAGGCTGGGACTGG - Intronic
1019481537 7:1269277-1269299 ACCCACACACAGGTTTGGCTGGG - Intergenic
1020515912 7:9118887-9118909 GCCTGGACACTGGCTGGGGTGGG - Intergenic
1023332626 7:39134677-39134699 GCTTGCACACAGATTGGAGTGGG - Intronic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1032020528 7:128405256-128405278 CCCTGCCCACAGGTTGGTATTGG - Intronic
1032401389 7:131626738-131626760 GCCTGCACAGAGGTGGCTCTAGG - Intergenic
1032473333 7:132194134-132194156 GCCTGCATGCTGGCTGGGCTTGG + Exonic
1034171442 7:149065936-149065958 GCCTGGACACGGCTCGGGCTGGG + Intergenic
1034254235 7:149715518-149715540 GCCTGGGCACCGTTTGGGCTAGG + Intronic
1036147839 8:6270857-6270879 GGCTCCACACAGGTGGGGCACGG + Intergenic
1036704302 8:11035170-11035192 GCTTGCACCCACGCTGGGCTGGG - Intronic
1037314893 8:17591623-17591645 GCCTGCAGGCAGGCTGGGCACGG + Intronic
1038704834 8:29883974-29883996 GCCTGCACAGGGGTAGGGCCTGG + Intergenic
1040027364 8:42794342-42794364 GCCTGCACACAGGGAGGACAGGG - Intronic
1047219856 8:122910706-122910728 GCCTGCACACTGGCTGGGGAAGG - Intronic
1049024777 8:139980793-139980815 GTCTGCAGACAGGGTGGGCGTGG + Intronic
1049605912 8:143529119-143529141 GCCTGGCCAGAGGTTGGGCCTGG + Intronic
1057915651 9:99053325-99053347 GTTTGCAAACAGGCTGGGCTTGG - Intronic
1060039230 9:120285424-120285446 GCCTGCACATTGGCTGAGCTTGG + Intergenic
1060430699 9:123549151-123549173 CCCTCCACACAGGTTGGGAGTGG - Intronic
1061059802 9:128244738-128244760 GTCTGCACATTGGTTAGGCTGGG - Intronic
1062280810 9:135750861-135750883 GCCTGCACCCGGGTCTGGCTGGG - Intronic
1062338780 9:136084288-136084310 GGCTGGACACAGGAGGGGCTGGG - Intronic
1062446938 9:136599058-136599080 GCCTGCCCTCATGTTGGGGTGGG + Intergenic
1189900940 X:45705750-45705772 GCCTGCATATAGGTTGGGCAGGG - Intergenic
1190294172 X:49014857-49014879 GCCTGTAAACAGGCTGGGCGCGG - Intergenic
1190455802 X:50626825-50626847 GCCTGCCCACAGCTTGAGCAGGG - Intronic
1191831598 X:65421350-65421372 GGCTGTACATAGGTTGGCCTTGG - Intronic
1200073577 X:153540612-153540634 GCCTGCAAAGAGGGTGGGCAGGG - Intronic