ID: 1006624994

View in Genome Browser
Species Human (GRCh38)
Location 6:35391474-35391496
Sequence GCTTACATCAGGAGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006624990_1006624994 4 Left 1006624990 6:35391447-35391469 CCACATAGATGAGGTGTGCTTCC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1006624994 6:35391474-35391496 GCTTACATCAGGAGGCACAGTGG 0: 1
1: 0
2: 0
3: 7
4: 176
1006624989_1006624994 5 Left 1006624989 6:35391446-35391468 CCCACATAGATGAGGTGTGCTTC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1006624994 6:35391474-35391496 GCTTACATCAGGAGGCACAGTGG 0: 1
1: 0
2: 0
3: 7
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006624994 Original CRISPR GCTTACATCAGGAGGCACAG TGG Intronic