ID: 1006625122

View in Genome Browser
Species Human (GRCh38)
Location 6:35392414-35392436
Sequence CAGTCTGGGCAGGCGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1073
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 987}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006625122_1006625133 19 Left 1006625122 6:35392414-35392436 CCAGCCTCCGCCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 80
4: 987
Right 1006625133 6:35392456-35392478 ACCTGGCACTGGCCCACTTTAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006625122_1006625132 8 Left 1006625122 6:35392414-35392436 CCAGCCTCCGCCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 80
4: 987
Right 1006625132 6:35392445-35392467 AGGCTGCACATACCTGGCACTGG 0: 1
1: 0
2: 1
3: 20
4: 180
1006625122_1006625135 20 Left 1006625122 6:35392414-35392436 CCAGCCTCCGCCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 80
4: 987
Right 1006625135 6:35392457-35392479 CCTGGCACTGGCCCACTTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 141
1006625122_1006625131 2 Left 1006625122 6:35392414-35392436 CCAGCCTCCGCCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 80
4: 987
Right 1006625131 6:35392439-35392461 AAGTACAGGCTGCACATACCTGG 0: 1
1: 1
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006625122 Original CRISPR CAGTCTGGGCAGGCGGAGGC TGG (reversed) Intronic
900134044 1:1106731-1106753 CTCTCTGGGCTGGCCGAGGCCGG + Intronic
900195615 1:1374237-1374259 CAGTCTGGGCAGGAAGCAGCGGG + Exonic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900304922 1:2001014-2001036 CAGGCTGGGCTGTCGGAGCCTGG + Intronic
900421668 1:2558491-2558513 CAGGCTGCCCAAGCGGAGGCTGG - Intronic
900428969 1:2593089-2593111 CAGTCTGAGTAGGCTGAGCCTGG + Intronic
900512254 1:3066334-3066356 AAGTCTGGCCACGCGGGGGCAGG + Intergenic
900586302 1:3433812-3433834 CGGGCTGGGCAGCCGGGGGCCGG + Exonic
900594793 1:3475856-3475878 CACTGTGGGCAGCCAGAGGCTGG + Intronic
900623366 1:3597278-3597300 CAGGGTGGGCAGGCGGATCCTGG - Intronic
900934130 1:5754679-5754701 CACTTTGGGGAGGCTGAGGCGGG - Intergenic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901063842 1:6485671-6485693 TCGCCCGGGCAGGCGGAGGCGGG - Intronic
901147053 1:7072295-7072317 ATGTCTGGGCAGCCAGAGGCAGG + Intronic
901647879 1:10726475-10726497 CAGGCTGGCCAGGCTGGGGCCGG + Intronic
901875817 1:12166738-12166760 GAGGCCGGGCAGGTGGAGGCCGG + Intergenic
901929147 1:12585800-12585822 AGGACTGGGCGGGCGGAGGCGGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902148215 1:14420946-14420968 CTCTCTGGGCTGGCGGAGGCCGG - Intergenic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902234692 1:15049776-15049798 CACTTTGGGGAGGCCGAGGCAGG + Intronic
902321686 1:15672133-15672155 CACTTTGGGAAGGCTGAGGCAGG + Intergenic
902680725 1:18042168-18042190 TACCCTGTGCAGGCGGAGGCAGG + Intergenic
903071034 1:20727119-20727141 GAGGCTGGGCAGGCCAAGGCAGG - Intronic
903079199 1:20795541-20795563 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
903188186 1:21641164-21641186 CACTCTGGGGAGGCCGAGGTGGG - Intronic
903469854 1:23579107-23579129 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
903476554 1:23623305-23623327 CACTTTGGGAAGGCTGAGGCAGG - Intronic
903594636 1:24484686-24484708 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
903611965 1:24621702-24621724 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
903777196 1:25800501-25800523 GAGTCGGGGGAGGCGGAGGGCGG + Intronic
903996495 1:27308097-27308119 CAGGCTGGGCAGGCAGGGGGTGG - Exonic
904028876 1:27521617-27521639 CAGTCAGGGCTGCCGGAGCCGGG + Intergenic
904088219 1:27926086-27926108 AGGTCTGGGGAGGCTGAGGCAGG - Intergenic
904209432 1:28876872-28876894 CCATTTTGGCAGGCGGAGGCAGG - Intergenic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904521995 1:31102785-31102807 CAGTATGGGGAGGTGGAGTCAGG - Intergenic
904664155 1:32107364-32107386 CACTTTGGGTAGGCCGAGGCGGG - Intergenic
904719576 1:32497997-32498019 CACTTTGGGAAGGCCGAGGCAGG + Intronic
904744614 1:32703036-32703058 CAGCCTGGGAGGGTGGAGGCAGG + Exonic
905132985 1:35775454-35775476 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
905209408 1:36363189-36363211 CTGTCTCGGGAGGCTGAGGCAGG + Intronic
905394160 1:37656681-37656703 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
905615456 1:39394509-39394531 CTGTTTGGGGAGGCTGAGGCAGG + Intronic
905672505 1:39801239-39801261 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
905892179 1:41524466-41524488 CAGGCTGGGCAGGCCAGGGCCGG + Intronic
906056031 1:42917405-42917427 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
906265327 1:44424584-44424606 GAGTCTGGGCAGGCAGGGGAAGG + Intronic
906270378 1:44473081-44473103 TAGGCAGGGCAGGAGGAGGCAGG + Intronic
906314019 1:44774780-44774802 CACTTTTGGGAGGCGGAGGCGGG - Intergenic
906400935 1:45504166-45504188 CACTTTAGGGAGGCGGAGGCGGG + Intronic
906524017 1:46484023-46484045 CAGTTTGGGAATGCTGAGGCTGG + Intergenic
907045035 1:51295419-51295441 CAGCCTTGGCAGGTGGAGGATGG - Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907561571 1:55394804-55394826 CACTTTGGGAAGGCTGAGGCAGG - Intergenic
907797533 1:57732408-57732430 CAGCCTGAGCAGGCGGAGAGAGG + Intronic
908401254 1:63774523-63774545 GGGTCTGGGCGGGCGGGGGCCGG - Intronic
908439929 1:64143272-64143294 CACTCTAGGAAGGCCGAGGCAGG + Intronic
908951593 1:69568322-69568344 CGCGCTGGGCAGGCTGAGGCTGG + Intergenic
909335192 1:74465223-74465245 CTCTCTGGGCTGGCCGAGGCCGG + Intronic
909962346 1:81861773-81861795 CAGACTCGGGAGGCTGAGGCAGG + Intronic
910197414 1:84657885-84657907 CACTCTGGGGAGGCCAAGGCAGG + Intronic
910578041 1:88789414-88789436 CACTTTGGGGAGGCCGAGGCGGG + Intronic
911114839 1:94236860-94236882 CAGTCAGGGCAGGTGGGAGCGGG + Intronic
911509924 1:98799007-98799029 TAGTTTGGGGAGGCCGAGGCGGG - Intergenic
911950823 1:104172268-104172290 CTGTCTGGGCTGGCCGAGGCCGG + Intergenic
912429079 1:109619795-109619817 CGGGGTCGGCAGGCGGAGGCGGG + Intronic
912622099 1:111171981-111172003 CACTTTGGGGAGGCCGAGGCAGG - Intronic
912840088 1:113031754-113031776 CACTTTGGGAAGGCAGAGGCGGG + Intergenic
913178698 1:116298405-116298427 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
914232735 1:145779419-145779441 CACTTTGGGAGGGCGGAGGCAGG - Intronic
914424889 1:147566508-147566530 CACTTTGGGGAGGCCGAGGCAGG + Intronic
914433742 1:147641849-147641871 CGGGAAGGGCAGGCGGAGGCGGG + Intronic
914819778 1:151092041-151092063 CAGTGTTGGGAGGCTGAGGCAGG - Intronic
914861972 1:151394056-151394078 CTACCTGGGCAGGCAGAGGCAGG + Intergenic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915261169 1:154677980-154678002 CTTTCTGGGCTGGCCGAGGCTGG + Intergenic
915543620 1:156583626-156583648 AATTCTGGGCAGGTGGTGGCAGG + Intronic
915567052 1:156720856-156720878 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
915916070 1:159941752-159941774 AGGCCTGGGCAGGCGGAGGCAGG + Intronic
916224334 1:162474675-162474697 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
916798121 1:168186720-168186742 GAGACTGGGGAGGCTGAGGCAGG + Intronic
917121082 1:171645328-171645350 GAGTCAGGGCAGGCACAGGCAGG - Intronic
917808503 1:178635544-178635566 CAGACTGGGGAGGCTGAGGCGGG + Intergenic
917852472 1:179077191-179077213 TACTCTGGGGAGGCTGAGGCAGG + Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918154524 1:181832358-181832380 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
918720784 1:187850144-187850166 GAGGCTGGGCTGGCGAAGGCCGG + Intergenic
918918199 1:190671584-190671606 CAGGCTGGGAAAGAGGAGGCAGG + Intergenic
919386815 1:196933641-196933663 CTTTCTGGGCTGGCTGAGGCCGG + Intronic
919743209 1:200992732-200992754 CAGTCTGGGTTGCTGGAGGCAGG + Intronic
920255218 1:204650062-204650084 CAGGCTGGGCAGGTGCTGGCAGG - Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920319135 1:205104274-205104296 CACTTTGGGGAGGCTGAGGCGGG + Intronic
920373305 1:205493040-205493062 CAGTCTGGACAGGCGTAAGGTGG - Intergenic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
920878510 1:209859068-209859090 CTTTCTGGGCTGGCTGAGGCCGG - Intergenic
921094478 1:211874710-211874732 CTTTCTGGGCTGGCCGAGGCTGG - Intergenic
921192182 1:212720303-212720325 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
921255103 1:213331856-213331878 CAGCCTGGGCAGGCAGAGAGAGG - Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
922013951 1:221623833-221623855 CAGCCTTGGGAAGCGGAGGCAGG - Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922166190 1:223117353-223117375 CTCTCTGGGCTGGCTGAGGCCGG - Intronic
922221284 1:223610419-223610441 CATTCTGGGCAGGAGAATGCTGG + Intronic
922417022 1:225431308-225431330 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
922513418 1:226187899-226187921 CACTTTGGGGAGGCTGAGGCGGG - Intergenic
922546802 1:226464140-226464162 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
922587282 1:226744118-226744140 CATTTTGGGGAGGCTGAGGCGGG + Intergenic
922777773 1:228224656-228224678 CAGGCAGGCCAGGCGGATGCCGG + Exonic
922783056 1:228268727-228268749 CAGGCGGGCCAGGCAGAGGCCGG + Exonic
922783860 1:228273469-228273491 CAGGCGGGCCAGGCGGATGCTGG + Exonic
923025446 1:230200306-230200328 CACTTTGGGGAGGCCGAGGCAGG - Intronic
923445773 1:234069861-234069883 CAGTCTGGGCAGTACGAGACTGG - Intronic
923548976 1:234946245-234946267 CAGCTTGGGGAGGCTGAGGCAGG + Intergenic
924244788 1:242073637-242073659 AGGTCTTGGCAGGCTGAGGCGGG + Intergenic
924305895 1:242689367-242689389 CTCTCTGGGCTGGCTGAGGCTGG + Intergenic
924335545 1:242983501-242983523 CAGTTTGGGGAGGCCAAGGCAGG + Intergenic
924403647 1:243718559-243718581 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
924712837 1:246545049-246545071 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1062874993 10:935988-936010 CATTTTTGGGAGGCGGAGGCAGG - Intergenic
1062927682 10:1329109-1329131 CAGTGTGGGCAGCCTGTGGCAGG + Intronic
1063020086 10:2118427-2118449 CAGTGTGCACAGGCAGAGGCAGG - Intergenic
1063031229 10:2237599-2237621 TTGTCTGGGGAGGCTGAGGCAGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063848660 10:10160846-10160868 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1063873206 10:10442711-10442733 CAATCTTGGAAGGCTGAGGCAGG + Intergenic
1063884506 10:10563494-10563516 CAGACTTGGAAGGCTGAGGCAGG + Intergenic
1064047879 10:12034557-12034579 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1064445417 10:15388630-15388652 CAGTTTGGGGAGGCCAAGGCAGG - Intergenic
1064803222 10:19099872-19099894 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1065132523 10:22636507-22636529 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1065554855 10:26905489-26905511 CGCTCTGGGCTGGCTGAGGCCGG + Intergenic
1065870234 10:29950215-29950237 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1066147552 10:32577115-32577137 CATTTTGGGGAGGCTGAGGCAGG + Intronic
1066231609 10:33440191-33440213 GCGTCTGGGGAGGCTGAGGCAGG + Intergenic
1066263112 10:33748295-33748317 CACTTTGGGGAGGCTGAGGCGGG - Intergenic
1066568647 10:36748256-36748278 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1066590609 10:36989707-36989729 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1066978396 10:42389898-42389920 CAGTCTTGGGAGGCTGAGGCAGG + Intergenic
1067278597 10:44854931-44854953 CATTCTGGGCAGGTGGCTGCTGG - Intergenic
1067462171 10:46465976-46465998 CAGGCTGGGCGGGCGCAGGCGGG - Intergenic
1067625025 10:47918622-47918644 CAGGCTGGGCGGGCGCAGGCGGG + Intergenic
1068216620 10:53990754-53990776 CTCTCTGGGCTGGCTGAGGCTGG + Intronic
1068689065 10:59897499-59897521 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1069280890 10:66651859-66651881 CTCTCTGGGCTGGCCGAGGCAGG - Intronic
1069783147 10:70969401-70969423 CAGGCTGGGCCGGTGGGGGCCGG + Intergenic
1069872266 10:71540417-71540439 GAGTCTGGGAAGGCTGGGGCGGG - Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070477203 10:76841198-76841220 CAGGCTTGGAAGGCCGAGGCGGG - Intergenic
1070626394 10:78054143-78054165 GAGTCTGGGCAGGCAGAGGAGGG + Intronic
1070648935 10:78221186-78221208 CAGTTTGGGAAAGCTGAGGCTGG + Intergenic
1071332135 10:84571143-84571165 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072658389 10:97346802-97346824 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1073360812 10:102897136-102897158 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1073837117 10:107457007-107457029 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074098075 10:110331394-110331416 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
1074316956 10:112369730-112369752 CTGCCTGGGCTGGCTGAGGCTGG + Intergenic
1074493064 10:113955966-113955988 CACTCTGGGGAGGGGTAGGCGGG + Intergenic
1074819254 10:117166572-117166594 CAGGCTGGGCTGGCGGAAGGGGG - Intergenic
1074846407 10:117402588-117402610 CACTCTTGGGAGGCTGAGGCAGG + Intergenic
1074978337 10:118598929-118598951 CAGTCAGGGTTGGTGGAGGCAGG - Intergenic
1075396353 10:122130526-122130548 CACTTTGGGGAGGCTGAGGCTGG - Intronic
1076506999 10:130984865-130984887 CAGTCTGGGGAGGTGCAGGTAGG - Intergenic
1076826785 10:132973379-132973401 CAGGCTGGGCAGGGGCAGACTGG + Intergenic
1076852711 10:133100899-133100921 CAGGCTCGGGAAGCGGAGGCAGG + Intronic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077393937 11:2312048-2312070 CAGGCAGGGCAGGCAGAGCCAGG + Intronic
1077555820 11:3225550-3225572 CAGGCTGGGCAGGGGCAGGTGGG + Intergenic
1078326270 11:10383700-10383722 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1079151566 11:17904389-17904411 CAGTCTGGCATGGTGGAGGCTGG - Intronic
1079689070 11:23400138-23400160 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
1081046456 11:38279018-38279040 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1081136205 11:39442480-39442502 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1081518442 11:43857459-43857481 CACTTTGGGGAGGCTGAGGCCGG + Intergenic
1081814157 11:45929242-45929264 CAGTCAGGGAGGGCAGAGGCTGG + Intergenic
1081944267 11:46975035-46975057 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1082051344 11:47772903-47772925 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1082069152 11:47924624-47924646 GAGTGTGGGCAGGCCCAGGCGGG + Intergenic
1082924586 11:58531892-58531914 CACTCTGGGCTGGCTGAGGCTGG + Intronic
1083145494 11:60755351-60755373 TAGTCTCGGGAGGCTGAGGCAGG - Intergenic
1083176059 11:60951175-60951197 CCGTCGGGGAAGGCGGTGGCGGG + Exonic
1083628631 11:64084770-64084792 CAGTCTGGGCTGGCGGGTGAGGG - Intronic
1083719877 11:64598869-64598891 CAGTCCGGGCATGCGGAGCAGGG - Exonic
1083843492 11:65317412-65317434 CATTCTGGGCAGGGTGAGGGTGG - Intronic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084054242 11:66621621-66621643 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1084209641 11:67615070-67615092 CTGTCTGGAGAAGCGGAGGCTGG - Intergenic
1084491591 11:69481540-69481562 CCCTCTGGGAATGCGGAGGCTGG + Intergenic
1084609937 11:70195590-70195612 CATTCTGGGCAGGCTCTGGCAGG - Intergenic
1084659696 11:70539635-70539657 GAGTCTGGGCAGGGAGAAGCTGG - Intronic
1084660566 11:70544235-70544257 CAGAGTGGGCAGGCCGGGGCTGG - Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084675272 11:70630361-70630383 CAGGCTGCCCAGGCAGAGGCGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085308790 11:75503878-75503900 CATTCAGGGCTGGGGGAGGCAGG - Intronic
1085556006 11:77422312-77422334 CACTCTGGGGAGGCTGAAGCGGG + Intronic
1085583727 11:77680184-77680206 CACTCTTGGGAGGCTGAGGCAGG + Intronic
1085640330 11:78189090-78189112 CAGGCCGGGCAGGACGAGGCTGG - Exonic
1085887014 11:80533165-80533187 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
1085962217 11:81475255-81475277 TAGTCTTGGGAGGCTGAGGCAGG - Intergenic
1086034853 11:82403844-82403866 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
1086200414 11:84195003-84195025 CTCTCTGGGCTGGCCGAGGCAGG - Intronic
1087411217 11:97792172-97792194 CACTCTTGGGAGGCCGAGGCAGG - Intergenic
1087683847 11:101241667-101241689 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
1087977314 11:104565352-104565374 CTGTCTGGGCTGGGTGAGGCCGG - Intergenic
1088605161 11:111522837-111522859 GAGGCTGGGCAGGCCAAGGCGGG + Intronic
1088896028 11:114078940-114078962 TAGTCGGGGGAGGCTGAGGCAGG + Intronic
1089021050 11:115215362-115215384 CATTCTGGGTAGGGGGATGCAGG - Intronic
1089244786 11:117110868-117110890 CTTTCTGGGCAGGCCGAGGCCGG - Intergenic
1090053588 11:123402260-123402282 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1091569139 12:1669373-1669395 CAGTCTCTGCTGGCTGAGGCTGG - Intergenic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091713757 12:2761413-2761435 ATGTCTGGGGAGGCAGAGGCAGG + Intergenic
1091804197 12:3344096-3344118 CAGGGTGGGCCGGCGGGGGCAGG + Intergenic
1092137378 12:6159419-6159441 CTTTCTGGGCCGGCGAAGGCCGG + Intergenic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092214324 12:6670180-6670202 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1092371278 12:7918352-7918374 CACTTTGGGAAGGCGGAGGTGGG + Intergenic
1094108737 12:26839121-26839143 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1095449461 12:42314703-42314725 TGGGCTGGGCAGGCTGAGGCAGG + Intronic
1095699390 12:45175253-45175275 TACTCTGGGGAGGCTGAGGCAGG + Intergenic
1096323023 12:50632074-50632096 CACTTTTGGAAGGCGGAGGCGGG - Intronic
1096951770 12:55479957-55479979 CGCACTGGGCAGGCTGAGGCAGG + Intergenic
1098207075 12:68122280-68122302 CAGGCTGGCCAGGCTGAGGTGGG + Intergenic
1098236624 12:68424133-68424155 CAGGCTTGGGAGGCCGAGGCGGG + Intergenic
1098275395 12:68807546-68807568 CACTTTGGGTAGGCCGAGGCGGG - Intergenic
1098738803 12:74144149-74144171 AAATCTGGGGAGGCTGAGGCGGG + Intergenic
1098885927 12:75960963-75960985 GTGTCTGGGGAGGCTGAGGCAGG - Intergenic
1099190253 12:79554422-79554444 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
1100315859 12:93443683-93443705 CAGTCTGGGCAGGGCTTGGCAGG + Intergenic
1101940957 12:109098453-109098475 CCGGCTGGGCAGGAGGAGCCTGG + Exonic
1102077636 12:110072834-110072856 GCGTGTGGGCAGGTGGAGGCAGG + Intronic
1102248111 12:111367926-111367948 CAGCCTGGACCTGCGGAGGCAGG - Intronic
1102569354 12:113818112-113818134 CAGCCTTGGGAGGCTGAGGCGGG + Exonic
1102675588 12:114656265-114656287 CAGTCAGGGCAGCAGGGGGCTGG - Intergenic
1102896055 12:116599514-116599536 CAATCTGGGCCAGGGGAGGCTGG + Intergenic
1102912128 12:116724468-116724490 CACTTTGGGGAGGCCGAGGCTGG + Intronic
1102959461 12:117083195-117083217 CAGTGCGGGGAGGCTGAGGCAGG - Intronic
1103297838 12:119903387-119903409 CAGCCCGGGAAGGCTGAGGCAGG + Intergenic
1103346861 12:120256967-120256989 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1103404906 12:120668249-120668271 CACTCTGGGGAGGCTGAGGCGGG + Intergenic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103785488 12:123429867-123429889 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1103801381 12:123540049-123540071 CACTTTGGGAAGGCTGAGGCAGG - Intergenic
1103806740 12:123579691-123579713 CATTCTGGGGAGGCTGAGGTGGG + Intergenic
1103811399 12:123616906-123616928 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1103978997 12:124723893-124723915 CATTTTGGGAAGGCCGAGGCAGG - Intergenic
1104373826 12:128247190-128247212 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104661604 12:130615555-130615577 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1104713018 12:130998060-130998082 CAGGCATGGCAGGCTGAGGCAGG + Intronic
1104937444 12:132374156-132374178 CAGGCTGGGCTGGCGGGGGCGGG - Intergenic
1104942226 12:132400534-132400556 CAGTCTGGGCAGGGCGTGGCCGG + Intergenic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1104986502 12:132600543-132600565 CACTCTGGCCAGGCAGCGGCCGG + Intergenic
1105070480 12:133231563-133231585 CCGTCTGGTCATGAGGAGGCTGG - Exonic
1105297225 13:19098479-19098501 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1105830951 13:24162324-24162346 CAGGCGGGGCAGGCTGTGGCTGG - Intronic
1106558997 13:30832945-30832967 TAGCCAGGGCAGGAGGAGGCTGG - Intergenic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1107456538 13:40560637-40560659 CAGTCTGGCCAGGAGGGTGCTGG - Exonic
1108210522 13:48135263-48135285 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1108353850 13:49612171-49612193 CACTTTGGGAAGGCCGAGGCAGG - Intergenic
1108671247 13:52691227-52691249 CACTTTGGGTAGGCTGAGGCAGG - Intronic
1109037775 13:57287024-57287046 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
1109211500 13:59540260-59540282 CATACTGGGTAGGCAGAGGCTGG + Intergenic
1109416497 13:62046956-62046978 CTCTCTGGGCTGGCAGAGGCTGG - Intergenic
1109918315 13:69021282-69021304 CTATCTTGGCAGGCTGAGGCAGG + Intergenic
1110219473 13:73058745-73058767 CAGATTGGGCTGGCGGAGCCGGG - Intronic
1110440144 13:75518496-75518518 CTGTCTGGGCTGGCCAAGGCCGG + Intergenic
1112906154 13:104425087-104425109 CACTTTGGGAAAGCGGAGGCGGG + Intergenic
1113489300 13:110678866-110678888 AAGGCAGCGCAGGCGGAGGCTGG + Intronic
1113680214 13:112238637-112238659 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
1113793865 13:113045479-113045501 CAGTCCCGGCGGGTGGAGGCCGG + Intronic
1114524502 14:23359544-23359566 CAGGCAGGGCAGGCAGAGGGCGG + Exonic
1115174645 14:30547935-30547957 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1115421401 14:33199157-33199179 CTCTCTGGGCTGGCAGAGGCTGG - Intronic
1116297957 14:43136346-43136368 CCCTCTGGGCTGGCCGAGGCCGG - Intergenic
1116900912 14:50361898-50361920 CTTTCTGGGCAGGCCAAGGCCGG + Intronic
1117082543 14:52166689-52166711 CTCTCTGGGCTGGCTGAGGCTGG + Intergenic
1117683403 14:58228370-58228392 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1117687517 14:58269676-58269698 CACTTTGGGGAGGCAGAGGCGGG - Intronic
1118191384 14:63583659-63583681 CAGGCTTGGGAGGCCGAGGCAGG + Intergenic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1119510029 14:75203759-75203781 CAGGCTGGGCTGGCGGAGAATGG + Intergenic
1119636916 14:76280651-76280673 AGGTCAGGGCAGGAGGAGGCAGG + Intergenic
1119812471 14:77533910-77533932 CACTCTTGGGAGGCCGAGGCGGG + Intronic
1120692731 14:87611234-87611256 CACACTGGGGAGGCTGAGGCAGG + Intergenic
1120737498 14:88069648-88069670 CAGTGTTGGGAGGCGGAGCCTGG + Intergenic
1120978951 14:90274209-90274231 CAGCATGGGCAGGGTGAGGCTGG + Exonic
1121051832 14:90824274-90824296 CATTCTGGGCAGGGGGAGATAGG - Intergenic
1121297072 14:92836816-92836838 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1121303661 14:92891489-92891511 CAGTTTGGGCTGGAGGAAGCTGG - Intergenic
1121383166 14:93492463-93492485 CATACTGGGGAGGCTGAGGCAGG - Intronic
1121564613 14:94899618-94899640 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1121595280 14:95157434-95157456 CAGTCTCCGCAGGCGCCGGCGGG - Intronic
1122176403 14:99923186-99923208 CAGTTTTGGGAGGCCGAGGCAGG - Intronic
1122428844 14:101627439-101627461 GAGTTTGGGGAGGCTGAGGCAGG - Intergenic
1122434928 14:101689024-101689046 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1122477580 14:102021905-102021927 CACTCTGGGAGGGCAGAGGCAGG - Intronic
1122482073 14:102053856-102053878 TAGTCTGGGGAGGCTGAGGTGGG - Intergenic
1122598091 14:102907350-102907372 CCATCTGGGCAGGCACAGGCTGG - Exonic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1122814937 14:104307653-104307675 CAGCCTGGGCAGGAGAGGGCCGG + Intergenic
1123051827 14:105547773-105547795 TTGTCTGGGCTGGCCGAGGCCGG + Intergenic
1202878901 14_KI270722v1_random:38547-38569 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1123957853 15:25358123-25358145 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1124198630 15:27656821-27656843 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
1124418181 15:29491290-29491312 CACTCTGGGCTGGCCGAGGCAGG - Intronic
1124577126 15:30919575-30919597 CAGCCTCGGAAGGCTGAGGCAGG + Intronic
1124643848 15:31420656-31420678 CAGTCTGGGCAGCCTGGGTCAGG - Intronic
1124897419 15:33789920-33789942 CAGTTTGGGGAAGCCGAGGCAGG - Intronic
1125524830 15:40368286-40368308 CAGCGTGGGCAGCCGCAGGCGGG - Exonic
1125599480 15:40907421-40907443 CAGGCTGGGCATCCCGAGGCTGG + Intergenic
1125648897 15:41297081-41297103 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
1127120679 15:55769163-55769185 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127306076 15:57706823-57706845 CATTCTGCGCGGGCTGAGGCTGG - Exonic
1127861585 15:62998236-62998258 CATGCTGGGCAGGTGGGGGCAGG + Intergenic
1127916385 15:63459007-63459029 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1128004575 15:64226442-64226464 CAGACTAGGGAGGCTGAGGCAGG + Intronic
1128038949 15:64552891-64552913 CACTCTGGGGAGGCAGAGGTGGG - Intronic
1128051276 15:64666880-64666902 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1128090348 15:64914971-64914993 CAGCGTGGGCAGGTGGAAGCTGG + Intronic
1128236786 15:66073145-66073167 CAGGCTGGCGAGGCGGAGGTGGG - Intronic
1128542633 15:68546460-68546482 TAGTCTGGGCTGGAGGTGGCTGG - Intergenic
1128757282 15:70191575-70191597 CAGCATGGCCAGGAGGAGGCGGG + Intergenic
1129191379 15:73939588-73939610 CTGCCTGGGGTGGCGGAGGCGGG + Intronic
1129596415 15:76967683-76967705 AAGTCTGGGCAGACAAAGGCAGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129717451 15:77860444-77860466 CGCTCTGTGCTGGCGGAGGCTGG - Intergenic
1129832402 15:78679424-78679446 CTTCCTGGGCAGGCTGAGGCAGG + Intronic
1131005025 15:88971005-88971027 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1131050769 15:89346433-89346455 CAGTTTGGACAGGTGGAGCCAGG - Intergenic
1131283586 15:91039995-91040017 CTTCCTGGGCAGGCTGAGGCAGG - Intergenic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1131912535 15:97224190-97224212 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1132124234 15:99207511-99207533 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1132155880 15:99495026-99495048 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
1132184695 15:99792743-99792765 CAGGGTGGGCAGGCAGGGGCAGG + Intergenic
1132432288 15:101771911-101771933 CAGGGTGGGCAGGCAGGGGCAGG - Intergenic
1132532911 16:462479-462501 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1132701353 16:1223488-1223510 CACCCTCCGCAGGCGGAGGCTGG + Exonic
1132723506 16:1328302-1328324 CAGGCTCGGGAGGCCGAGGCAGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132895667 16:2228326-2228348 GGGCCTGGGAAGGCGGAGGCTGG - Intronic
1133134208 16:3698420-3698442 TAGTCTTGGGAGGCTGAGGCAGG - Intronic
1133504292 16:6395817-6395839 CAGTTTTGGGAGGCTGAGGCAGG + Intronic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134270149 16:12725948-12725970 GAGGCTGGGGAGGCTGAGGCAGG + Intronic
1134392408 16:13831717-13831739 CAGTTTGGGGAGGCCAAGGCAGG - Intergenic
1134485843 16:14657786-14657808 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1134746225 16:16591010-16591032 CAGTCAGGGCTGCCAGAGGCTGG - Intergenic
1134883339 16:17767489-17767511 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
1134999256 16:18762690-18762712 CAGTCAGGGCTGCCAGAGGCTGG + Intergenic
1135137352 16:19895019-19895041 CAGACAGGGCAGGCTGAGGTGGG + Intergenic
1135186588 16:20321160-20321182 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1135432395 16:22396665-22396687 CAGTCTGCCCAGGAGGAGCCTGG + Intronic
1135572017 16:23557091-23557113 CAGAGTGGGCGGGCGGAGGAGGG - Intronic
1135729811 16:24884595-24884617 CAGCTTGGGGAGGCTGAGGCAGG - Intronic
1136356592 16:29748301-29748323 CTCTCTGGGCTGGCCGAGGCGGG + Intergenic
1136708437 16:32210963-32210985 CATTTTGGGGAGGCCGAGGCAGG + Intergenic
1136932509 16:34432074-34432096 CCGTCTGGGCAGGCTGAGGCTGG - Intergenic
1136972063 16:34979740-34979762 CCGTCTGGGCAGGCTGAGGCTGG + Intergenic
1137261189 16:46831213-46831235 GGGACTGGGCGGGCGGAGGCCGG - Exonic
1137400974 16:48154220-48154242 CAGACTGGACAGGCAGAAGCAGG + Intronic
1137425584 16:48377639-48377661 CACTTTGGGGAGGCCGAGGCTGG - Intronic
1137454945 16:48610773-48610795 CAGTCTGTGGGGGCAGAGGCGGG + Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1137722926 16:50638412-50638434 TGGTCTGGGGAGGCCGAGGCAGG - Exonic
1137876634 16:52003028-52003050 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1138889935 16:61129198-61129220 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1139471174 16:67178975-67178997 CAGTTTGGGCAGGGGGGTGCAGG - Intronic
1139604414 16:68007865-68007887 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1139690352 16:68637775-68637797 CACTTTGGGAAGGCTGAGGCGGG - Intronic
1139720832 16:68852581-68852603 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1139768899 16:69256264-69256286 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1139831663 16:69803659-69803681 CAGACCTGGGAGGCGGAGGCAGG + Intronic
1139850884 16:69951131-69951153 CGGGCTGGCCAGGCCGAGGCCGG + Intronic
1139879866 16:70174043-70174065 CGGGCTGGCCAGGCCGAGGCCGG + Intronic
1140372653 16:74421505-74421527 CGGGCTGGCCAGGCCGAGGCCGG - Intronic
1141667872 16:85475197-85475219 GGGTCTGGGCTGGTGGAGGCAGG - Intergenic
1141946041 16:87310782-87310804 TAGTGTGGGAAGGAGGAGGCAGG + Intronic
1142128487 16:88421638-88421660 CAAGCTGGGCAGGCAGAGGCAGG + Intergenic
1142156385 16:88534512-88534534 CAGTAGGGGCAGGCGGCGGCGGG - Exonic
1142323786 16:89401203-89401225 CCGTCTTGGAAGGCTGAGGCAGG - Intronic
1203061621 16_KI270728v1_random:978754-978776 CATTTTGGGGAGGCCGAGGCAGG - Intergenic
1142586576 17:978627-978649 CAGCCTGGGGCGGGGGAGGCGGG + Intronic
1142740826 17:1931004-1931026 CAGCCTGGGAAGGAGGAGACCGG + Intergenic
1143149509 17:4798883-4798905 GAGGCTGGGCTGGAGGAGGCTGG - Intergenic
1143151862 17:4812059-4812081 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1143229303 17:5338454-5338476 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1143267082 17:5646544-5646566 CAGTTTGGGGAGGCTGAGGCGGG - Intergenic
1143533617 17:7522139-7522161 CACTTTGGGAAGGCCGAGGCAGG - Intergenic
1143688320 17:8537966-8537988 CAGTCTGGCAAGGCAGGGGCTGG + Intronic
1143840408 17:9727214-9727236 CAGTCTTGGGAGGCTGAGGCAGG - Intronic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1144128032 17:12220845-12220867 CTTTCTGGGCAGGCCAAGGCCGG + Intergenic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1145721492 17:27077255-27077277 CACTTTGGGGAGGCTGAGGCTGG + Intergenic
1145938356 17:28727864-28727886 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1145963853 17:28903051-28903073 CAGCCTCCGAAGGCGGAGGCGGG + Exonic
1146278541 17:31530527-31530549 CACTCTGGGCAGGTGGGGGCCGG - Intronic
1146323189 17:31862816-31862838 CACTTTGGGAAGGCTGAGGCAGG - Exonic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147300262 17:39520957-39520979 CAGCTTGGGAAGGCTGAGGCAGG - Intronic
1147774206 17:42889113-42889135 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1147950892 17:44107361-44107383 CACTGTGGGGAGGCTGAGGCAGG + Intronic
1148037062 17:44672226-44672248 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1148102219 17:45099241-45099263 CACTGTGGGGAGGGGGAGGCTGG + Intronic
1148147335 17:45374012-45374034 CAGCTTGCGCAGGCAGAGGCTGG - Intergenic
1148593415 17:48833433-48833455 TAGTCTTGGGAGGCTGAGGCAGG + Intronic
1148673572 17:49431755-49431777 CACTTTGGGCAGGTGGAGGTGGG - Intronic
1149463741 17:56856850-56856872 CACTTTTGGGAGGCGGAGGCAGG + Intronic
1149486338 17:57045895-57045917 CCGCGTGGGGAGGCGGAGGCGGG - Intergenic
1149531975 17:57402738-57402760 AAGGCTGGGCTGGAGGAGGCTGG - Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1150096216 17:62378449-62378471 GAGCCTTGGGAGGCGGAGGCAGG + Intronic
1150155477 17:62849556-62849578 CATTTTGGGAAGGCCGAGGCAGG - Intergenic
1150227308 17:63531038-63531060 CAGGCAGGGCAGGATGAGGCTGG + Intronic
1151279164 17:73059418-73059440 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1151317131 17:73329853-73329875 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1151480156 17:74365794-74365816 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1151555112 17:74842808-74842830 CCGTCGGGGCGGGCGCAGGCGGG + Exonic
1151567517 17:74907459-74907481 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
1151626428 17:75278734-75278756 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1151656933 17:75500552-75500574 CAGTGAGGGAAGGCGGGGGCAGG + Exonic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151829371 17:76540583-76540605 GAGTCTGGGCTGGGGGAGGGAGG + Intronic
1151840701 17:76615327-76615349 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152346314 17:79754391-79754413 CATTCTGGGTGGGCGGTGGCAGG - Intergenic
1152492851 17:80649420-80649442 GAGTTTGGGCAGGAGGAGGGAGG - Intronic
1152755383 17:82084976-82084998 CAGGCTGGGGATGGGGAGGCTGG + Intronic
1152760033 17:82103010-82103032 CAGTCTGGACAGGCTGACCCAGG + Intronic
1152762877 17:82118584-82118606 CACTCTAGGGAGGTGGAGGCAGG + Intronic
1152875501 17:82784422-82784444 AGGTCAGGGCAGGCTGAGGCTGG + Intronic
1153553314 18:6284872-6284894 CAGCGTGGGCAGTCGGAGCCCGG + Intronic
1153759693 18:8318541-8318563 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1154028073 18:10725893-10725915 CAGGCTGGGCAGGAGGGTGCAGG + Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154294159 18:13135085-13135107 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1155003263 18:21706458-21706480 CTCTCTGGGCTGGCTGAGGCCGG + Intronic
1156421096 18:36954246-36954268 CAGACTTGGGAGGCCGAGGCGGG - Intronic
1156657776 18:39309036-39309058 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1156683518 18:39618400-39618422 CTGTCTGGGCTGGCCAAGGCTGG + Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157374709 18:47151923-47151945 CTGTCTGGGGAGGCTGAGGCAGG - Intronic
1157503953 18:48212895-48212917 CAGGCTGGCCAGGCAGAGGAGGG - Intronic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1157935233 18:51864784-51864806 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1158553826 18:58459334-58459356 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
1159078212 18:63705321-63705343 CAGCTTTGGGAGGCGGAGGCAGG - Intronic
1159260541 18:66006372-66006394 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
1160513408 18:79465444-79465466 CAGGCTGGCTGGGCGGAGGCGGG - Intronic
1160564697 18:79779873-79779895 CAGACTGGGAGGTCGGAGGCCGG + Intergenic
1160619459 18:80160553-80160575 CTCGCTGTGCAGGCGGAGGCGGG - Exonic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160746240 19:712267-712289 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1160793141 19:932284-932306 CAGTCTGAGCTGGCGGCGGCCGG + Intronic
1160865952 19:1255984-1256006 CAGGCCTGGCAGGCCGAGGCGGG + Intronic
1161064951 19:2233004-2233026 CAGCCAGGACAGGTGGAGGCTGG - Intronic
1161175710 19:2841271-2841293 CAGTCAGGACGGGCGGGGGCGGG + Intergenic
1161215865 19:3094827-3094849 CAGGCAGGGCAGGCACAGGCAGG - Intronic
1161223518 19:3130884-3130906 CACTCTAGGGAGGCCGAGGCGGG + Intergenic
1161287025 19:3473874-3473896 CATTGTGGCCAGGCTGAGGCTGG + Intergenic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161351990 19:3798622-3798644 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1161467988 19:4442782-4442804 CAGTGGGGACAGGCAGAGGCTGG - Intronic
1161496633 19:4590122-4590144 CACTCTGGGGAGGCTGAGGTGGG - Intergenic
1161746739 19:6064739-6064761 GATTCTGGCCAGGAGGAGGCTGG + Intronic
1162024926 19:7888487-7888509 GAGTCAGGGCAGGCGGGGACAGG - Exonic
1162091140 19:8280769-8280791 CTCTCTGGGCTGGCCGAGGCTGG - Intronic
1162093374 19:8295607-8295629 CTCTCTGGGCTGGCCGAGGCTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162233170 19:9283872-9283894 CTTTCTGGGCAGGCCAAGGCCGG - Intergenic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1163010785 19:14424623-14424645 CACTTTGGGGAGGCAGAGGCGGG - Intergenic
1163141385 19:15351365-15351387 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1163146680 19:15384544-15384566 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1163441660 19:17325008-17325030 GTGACTGGGCAGGGGGAGGCCGG + Exonic
1163495556 19:17644640-17644662 CAGTTTGGGACGGCTGAGGCAGG - Intronic
1163574542 19:18102976-18102998 CAGCCTGGGCAAGCGCAGACGGG + Intronic
1163583997 19:18154248-18154270 CAGCCTGGGGAGGCGGAGATAGG - Intronic
1163785515 19:19273063-19273085 CAGTGGGGGCGGGCGGGGGCGGG - Intronic
1164188803 19:22896827-22896849 GAGGCTGGGGAGGCTGAGGCAGG - Intergenic
1164229113 19:23272479-23272501 CAGACTTGGGAGGCTGAGGCGGG + Intergenic
1164693331 19:30226510-30226532 GAGCCTGGCCAGGCTGAGGCCGG + Intergenic
1164760256 19:30723113-30723135 ATGTCTGGCCAGGCGGAGGCAGG + Intergenic
1165036274 19:33036250-33036272 CAATCTTGGGAGGCTGAGGCAGG + Intronic
1165047333 19:33115738-33115760 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1165109822 19:33495737-33495759 CACTTTGGGAAGGCTGAGGCGGG + Intronic
1165307368 19:35010851-35010873 CATTTTGGGGAGGCTGAGGCAGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1166167686 19:41003877-41003899 CAGCCTGGGGAGGCGGATGTTGG + Intronic
1166196668 19:41210750-41210772 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1167075195 19:47244226-47244248 CGCTCGGGCCAGGCGGAGGCCGG + Intergenic
1167261175 19:48459126-48459148 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1167289301 19:48615637-48615659 CAGCCTGGGCTGGCAAAGGCCGG + Intronic
1167632306 19:50632618-50632640 CAGGCCTGGTAGGCGGAGGCGGG - Exonic
1167898537 19:52601226-52601248 GGGCCTGGGCAGGCGGAAGCGGG - Intronic
1168171686 19:54594124-54594146 CAGTGTGGACACTCGGAGGCTGG - Intronic
1168234651 19:55054472-55054494 TAGTCTTGGGAGGCTGAGGCAGG + Intronic
1168238234 19:55076531-55076553 CAGTCTGGGCTGCCGCAAGCGGG - Intronic
1168239846 19:55083578-55083600 CAGTCGGGTCAGGCGGGGCCAGG - Intronic
1168286957 19:55340026-55340048 CAGTCGGGGCAGGGGGCGACTGG - Intronic
1168659831 19:58157243-58157265 CTGTCTGGGCTGGTTGAGGCCGG + Intergenic
1202654521 1_KI270708v1_random:7560-7582 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
925293507 2:2763491-2763513 AAGGCTGGGCAGGCGGGGGTGGG + Intergenic
925532927 2:4884170-4884192 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
925710133 2:6731222-6731244 CAGTCTGAGTGGGCAGAGGCTGG + Intergenic
926124199 2:10261843-10261865 CAGTCCTGGGAGGCTGAGGCAGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927555190 2:24025997-24026019 CAGCCTGGGCAGGCCGAGTACGG - Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928599238 2:32886984-32887006 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
928619543 2:33074622-33074644 CACTTTGGGAAGGCCGAGGCAGG + Intronic
928991984 2:37242299-37242321 CAGCCTGAGAAGGCTGAGGCAGG - Intronic
929105429 2:38360526-38360548 CACTTTGGGGAGGCTGAGGCAGG - Intronic
929109820 2:38397254-38397276 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
929376393 2:41291233-41291255 AAGTCTGGGCAGGCTGAGATGGG + Intergenic
929397257 2:41537209-41537231 GAGACTGGGGAGGCTGAGGCAGG - Intergenic
930099216 2:47590109-47590131 CAGTCTGGGGAGGAGGTGACAGG + Intergenic
930420935 2:51152037-51152059 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
931354899 2:61528169-61528191 CACTTTGGGGAGGCTGAGGCAGG - Intronic
931549458 2:63426092-63426114 CACTCTTGGGAGGCCGAGGCAGG + Intronic
932155846 2:69416650-69416672 CACTTTGGGGAGGCCGAGGCGGG + Intronic
932644443 2:73486801-73486823 CACTTTGGGGAGGCTGAGGCAGG + Intronic
932814286 2:74849482-74849504 CAGGCTGGGGAATCGGAGGCAGG - Intronic
933139753 2:78778935-78778957 CTCTTTGGGCTGGCGGAGGCCGG + Intergenic
933415772 2:81985118-81985140 CTGTCTGGGCTGGCTGAGGCCGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
935061445 2:99611638-99611660 CACACTGGGGAGGCCGAGGCTGG + Intronic
935610528 2:105019611-105019633 CACTTTGGGAAGGCTGAGGCAGG + Intergenic
936292205 2:111234953-111234975 CACGCTGGGGAGGCTGAGGCAGG - Intergenic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
936922899 2:117707383-117707405 CACTTTGGGTAGGCCGAGGCAGG + Intergenic
937928345 2:127185063-127185085 CACTCTGGGGAGGTTGAGGCAGG - Exonic
937974750 2:127575865-127575887 CAGTTTTGGGAGGCTGAGGCGGG - Intronic
937978496 2:127596582-127596604 CACTGTGGGCAGGAGTAGGCTGG - Intronic
938122178 2:128641800-128641822 CTGTGTGGGCAGGCAGAGGCTGG + Intergenic
938599430 2:132821893-132821915 CAGTCAGGGCAGGGTTAGGCAGG - Intronic
938771327 2:134503708-134503730 CACTCAGCACAGGCGGAGGCAGG + Intronic
939886482 2:147686660-147686682 CTCTCTGGGCTGGCAGAGGCTGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
940323106 2:152398009-152398031 CAGCCTTGGGAGGCTGAGGCGGG + Intronic
940338983 2:152559548-152559570 CACTTTGGGGAGGCCGAGGCGGG - Intronic
941031865 2:160521199-160521221 CACTCTGGGGAGGCCGAGGCGGG - Intergenic
941223868 2:162820319-162820341 CAGTTTTGGGAGGCTGAGGCAGG - Intronic
942045873 2:172099156-172099178 GGGGCAGGGCAGGCGGAGGCTGG + Intergenic
943134384 2:183892477-183892499 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
943705048 2:191025730-191025752 CAGTCTTGGGAGTCTGAGGCAGG - Intergenic
944176787 2:196838797-196838819 CACTTTGGGGAGGCAGAGGCGGG + Exonic
944178106 2:196856261-196856283 CACTTTGGGGAGGCTGAGGCAGG - Intronic
944645827 2:201780608-201780630 CAGTCTGGGGAGGGAGAGACCGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
944728544 2:202496853-202496875 CTTTCTGGGCTGGCCGAGGCCGG + Intronic
945409952 2:209496281-209496303 CAGTCTGGGCAGGCAGGGTATGG + Intronic
945451535 2:210000987-210001009 CCGTCTGGGCTGGCCAAGGCCGG - Intergenic
945907943 2:215615303-215615325 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
945961864 2:216143958-216143980 CACTTTGGGGAGGCCGAGGCGGG - Intronic
946825191 2:223670650-223670672 TACTCTGGGGAGGCTGAGGCTGG - Intergenic
947224330 2:227825725-227825747 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
947510333 2:230747105-230747127 CACTTTGGGGAGGCCGAGGCAGG + Intronic
947740583 2:232483076-232483098 CAGGCTGGGCAGGCAGGGTCAGG + Intronic
947998928 2:234551695-234551717 CACTTTGGGAAGGCCGAGGCGGG - Intergenic
948054652 2:235002105-235002127 CACTCTGGGGAGGCCGAGGCGGG - Intronic
948186786 2:236027515-236027537 CAGTCTGCCCTGGGGGAGGCAGG - Intronic
948419787 2:237850230-237850252 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
948752322 2:240139807-240139829 CACACTGGGCAGGGGGAGCCAGG - Intronic
948888587 2:240896240-240896262 CATGCAGGGCAGGCGGGGGCTGG + Intronic
948919116 2:241053070-241053092 CAGTCGGGTCGGGCAGAGGCAGG + Intronic
1169223274 20:3839641-3839663 CACTCTGGGGAGGCTGAGGCAGG + Intergenic
1169351659 20:4872998-4873020 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1169958530 20:11132679-11132701 CAGTTTGGGGAGGCCGAGGCTGG + Intergenic
1170154784 20:13259167-13259189 CAGTCTTGGGAGGCTGAGGCAGG + Intronic
1170222050 20:13951485-13951507 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1170623211 20:18010987-18011009 CAGACTGGGCAGCCGGTGCCTGG + Intronic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1171997686 20:31744838-31744860 CACTCTGAGGAGGCTGAGGCGGG + Intronic
1172654646 20:36529440-36529462 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1173105467 20:40129341-40129363 AAGTCTGGGCAAGCTGATGCAGG - Intergenic
1173244716 20:41328458-41328480 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1173783388 20:45774828-45774850 CAGCCTTGGGAGGCTGAGGCAGG + Intronic
1173785157 20:45787651-45787673 TAGCCTGGGCAGGCAGAGGGAGG - Intronic
1173848174 20:46201113-46201135 CAGCATGGGGAAGCGGAGGCCGG - Intronic
1173880289 20:46406603-46406625 AAGGCGGGGCGGGCGGAGGCTGG - Exonic
1174089106 20:48032698-48032720 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1174627646 20:51928458-51928480 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1174813483 20:53666998-53667020 CACTTTGGGAAGGCCGAGGCGGG - Intergenic
1175136374 20:56827408-56827430 CAGGCCGGGCGGGCGGGGGCAGG - Intergenic
1175223011 20:57428361-57428383 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1175348740 20:58302604-58302626 GAGTTGGGGCAGGCGGAGGAAGG - Intergenic
1176121118 20:63455023-63455045 CTGCCTGGGCAGGAGGGGGCGGG - Intronic
1176640205 21:9295982-9296004 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1177089495 21:16749220-16749242 CTGTCTTGGGAGGCCGAGGCGGG - Intergenic
1177315376 21:19454019-19454041 CAGTCTGAGGTGGCAGAGGCAGG - Intergenic
1177971956 21:27801096-27801118 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
1178271048 21:31190157-31190179 CACTCTTGGAAGGCTGAGGCGGG + Intronic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178885267 21:36479914-36479936 GAGCCTGGGCAGGCGTAGGCTGG - Exonic
1179056909 21:37944739-37944761 GAGTCTGGGCAGGGGGCTGCTGG + Intergenic
1179457306 21:41508243-41508265 CACCCTGGGCGGGCGGGGGCGGG + Intronic
1179657456 21:42853996-42854018 CAGGCAGGGCAGGAGGACGCAGG + Intronic
1179893906 21:44350944-44350966 GAGACTGGGCAGGCAGAGGCGGG - Intronic
1180209712 21:46287444-46287466 CACTCTGGGAAGCCCGAGGCAGG - Intronic
1180349223 22:11785367-11785389 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1180373512 22:12068821-12068843 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1180388977 22:12206846-12206868 AAGTTTGGGCAGGCGGTTGCTGG - Intergenic
1180424248 22:12903445-12903467 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180663022 22:17485520-17485542 CACTCTTGGGAGGCCGAGGCAGG + Intronic
1180847049 22:18989213-18989235 CTGTCTGGGTCGGGGGAGGCAGG + Intergenic
1180895830 22:19331417-19331439 CAGCCAGGGCAGGCTGGGGCAGG + Exonic
1181540805 22:23572286-23572308 AACTCTGGGGAGGCTGAGGCAGG + Intergenic
1181761146 22:25059671-25059693 TAGTTTGGCCAGGCGGAGGGAGG + Intronic
1181800932 22:25347324-25347346 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1182434502 22:30321684-30321706 CAGACTGGGCGGACTGAGGCTGG + Intronic
1182633495 22:31706083-31706105 CACTTTGGGGAGGCTGAGGCGGG + Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183411119 22:37655523-37655545 GAGACTGGGCTGGGGGAGGCTGG - Exonic
1183932783 22:41245808-41245830 CAGTCTGGGGAGGGAGAGGCAGG - Exonic
1184226162 22:43129961-43129983 GAGTCTGTGCAGGGAGAGGCAGG - Intergenic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184862632 22:47182861-47182883 CACTCTGGGGAGGCCAAGGCAGG + Intergenic
1184873770 22:47259433-47259455 AATTCAGGGCAGGGGGAGGCAGG + Intergenic
1185011871 22:48319070-48319092 CAGTCTGTGCAGGCAGCGCCAGG - Intergenic
1185169712 22:49285661-49285683 TGGTCTGGGCAGGTGGGGGCGGG + Intergenic
1185348094 22:50319430-50319452 CAGTCTGGGCAAGAGGTGGTTGG - Intronic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
949258925 3:2083575-2083597 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
949281438 3:2352337-2352359 CTCTCTGGGCTGGCCGAGGCCGG + Intronic
949540633 3:5029342-5029364 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
950203548 3:11061325-11061347 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
950204902 3:11071640-11071662 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
950286659 3:11750554-11750576 GAGTTTGGGGAGGCTGAGGCAGG - Intergenic
950702881 3:14762181-14762203 CTGTGTGGGGAGGCTGAGGCAGG - Intronic
951011998 3:17692201-17692223 CCGTCTTGGGAGGCTGAGGCAGG - Intronic
951397203 3:22183600-22183622 CATTCTCGGGAGGCCGAGGCGGG - Intronic
951415389 3:22416895-22416917 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
951550839 3:23873499-23873521 CACTTTGGGGAGGCTGAGGCAGG + Intronic
952328933 3:32346040-32346062 CAGGCTTGGGAGGCCGAGGCAGG + Intronic
952391106 3:32881262-32881284 CACTCTTGGGAGGCTGAGGCAGG - Intronic
952713263 3:36453288-36453310 CATTCTGGGCTGGCCAAGGCCGG + Intronic
952821812 3:37492353-37492375 CAGCTTGGGAAGGCGGAGGCTGG + Intronic
953096227 3:39779693-39779715 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
953237039 3:41116014-41116036 CAGTGTTGGGAGGCCGAGGCAGG + Intergenic
954046749 3:47938123-47938145 CACTTTGGGAAGGCAGAGGCAGG + Intronic
954333662 3:49903905-49903927 CGGGCTGGGCGGGCGGAGTCGGG + Intronic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954558793 3:51538815-51538837 AAGTCTGCGGCGGCGGAGGCGGG - Intergenic
954761377 3:52877186-52877208 CAGGCTGGTCTGGCAGAGGCAGG - Intronic
954781654 3:53066372-53066394 CAGCCTTGGCAGGTGGAGGCAGG + Intronic
954807992 3:53231381-53231403 CAGGCTGGGCATGCGGATGTTGG + Exonic
955056423 3:55459657-55459679 CAGTCTGGGCAGGGGTAGCAGGG - Intergenic
955184065 3:56698416-56698438 CAGACTCGGGAGGCTGAGGCAGG - Intergenic
955577174 3:60378267-60378289 TAGTCTCGGGAGGCTGAGGCGGG - Intronic
957209482 3:77240501-77240523 CTCTCTGGGCTGGCCGAGGCTGG - Intronic
957560213 3:81812400-81812422 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
957607267 3:82417636-82417658 TAGTCTCGGGAGGCTGAGGCTGG + Intergenic
957921762 3:86757536-86757558 CTTTCTGGGCTGGCTGAGGCCGG + Intergenic
959462408 3:106643713-106643735 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
960024624 3:112994175-112994197 CACTTTGGGGAGGCCGAGGCTGG + Intronic
960121053 3:113948534-113948556 CAGCCTGGGCAGGCGCCGTCTGG - Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960627472 3:119695159-119695181 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
960769750 3:121180626-121180648 CACTTTGGGCAGGCCGAGGCAGG + Intronic
961333004 3:126154009-126154031 CAGTCTGGGCAGTCGGCTGGGGG + Intronic
962775910 3:138659403-138659425 CTGCCTGGGGAGGCTGAGGCAGG + Intronic
963121611 3:141781288-141781310 CACTTTGGGGAGGCCGAGGCGGG + Intronic
963533214 3:146497242-146497264 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
963554606 3:146772289-146772311 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
963583289 3:147154030-147154052 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
963791120 3:149583448-149583470 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
964111020 3:153087680-153087702 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
964129197 3:153268629-153268651 CTCTCTGGGCTGGCTGAGGCTGG + Intergenic
964376212 3:156051721-156051743 CTCTCTGGGCTGGTGGAGGCTGG + Intronic
964982553 3:162703337-162703359 CTTTCTGGGCTGGCCGAGGCAGG - Intergenic
965092198 3:164179196-164179218 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
965231242 3:166055447-166055469 CATTCTCGGGAGGCTGAGGCAGG + Intergenic
966061540 3:175762836-175762858 CACTTTGGGAAGGCCGAGGCAGG + Intronic
966172302 3:177095726-177095748 CACTTTGGGGAGGCCGAGGCAGG - Intronic
966183081 3:177204315-177204337 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
966817085 3:183898085-183898107 CAGTCTGGGGAAGTGGAGGGCGG - Intergenic
967005967 3:185382757-185382779 CACTTTGGGTAGGCCGAGGCGGG + Intronic
967499209 3:190177466-190177488 CTTTCTGGGCCGGCCGAGGCCGG - Intergenic
1202746689 3_GL000221v1_random:109040-109062 AAGTTTGGGCAGGCGGTTGCTGG - Intergenic
968516595 4:1018144-1018166 CAGTCTGGAGGGACGGAGGCAGG - Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968598101 4:1495699-1495721 CAGCTTGGACAGGCGGGGGCAGG + Intergenic
968837965 4:2979465-2979487 CACTTTGGGGAGGCCGAGGCGGG + Intronic
968949126 4:3681352-3681374 CGTTGTGTGCAGGCGGAGGCAGG + Intergenic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952546 4:3702416-3702438 CAGTCCGGGCAGTGGGAGGAGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968961760 4:3749114-3749136 CAGAAAGGGCAGGCAGAGGCAGG + Intergenic
969217129 4:5731517-5731539 CAGTCTGGGGAGCCTGAGCCAGG + Exonic
969228344 4:5813452-5813474 CACTTTGGGGAGGCCGAGGCAGG - Exonic
969303212 4:6309441-6309463 CCCTCTGGGCTGGCCGAGGCCGG - Intergenic
969303222 4:6309472-6309494 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
969403821 4:6975454-6975476 CACTTTGGGGAGGCTGAGGCAGG - Intronic
969576753 4:8040497-8040519 CAGACTTGGGAGGCTGAGGCAGG + Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970279277 4:14436223-14436245 CACTTTGGGGAGGCAGAGGCAGG + Intergenic
970315823 4:14827446-14827468 CACTGTGGGAAGGCCGAGGCAGG + Intergenic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
971618711 4:28827940-28827962 CTTTCTGGGCTGGCCGAGGCTGG + Intergenic
972374285 4:38456288-38456310 CAGGCTGTGCAGGTGCAGGCAGG + Intergenic
972552784 4:40148337-40148359 GGCACTGGGCAGGCGGAGGCAGG + Intronic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
972791686 4:42378268-42378290 CATTTTGGGGAGGCTGAGGCAGG - Intergenic
973039985 4:45457533-45457555 CTGTCTGGGCTGGCTGACGCTGG - Intergenic
973142043 4:46781622-46781644 CTCTCTGGGCTGGCTGAGGCCGG + Intronic
973317820 4:48779986-48780008 CAGGCTGGGCTGCCGGCGGCGGG + Intronic
973951944 4:56024889-56024911 CACTTTGGGGAGGCTGAGGCTGG + Intronic
974069822 4:57113392-57113414 CACTCTGGGAAGGCTGAGGCAGG - Intergenic
974089933 4:57300586-57300608 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
974147659 4:57967138-57967160 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
974186746 4:58456875-58456897 CTCTCTGGGCTGGTGGAGGCTGG + Intergenic
974187966 4:58465065-58465087 CTCTCTGGGCTGGTGGAGGCTGG + Intergenic
974839840 4:67287113-67287135 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
974904530 4:68038524-68038546 CATTCTGCGCGGGCTGAGGCTGG - Intergenic
975754774 4:77561831-77561853 CTCTCTGGGCTGGCCGAGGCTGG + Intronic
977762707 4:100758913-100758935 CATTGTGGGCAGGTGGAGGTAGG + Intronic
977885111 4:102244986-102245008 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
977885817 4:102250703-102250725 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
978030542 4:103936721-103936743 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
978466202 4:109012417-109012439 CTGTCTGGGCTGGCCAAGGCCGG + Intronic
979241573 4:118451779-118451801 CAGTTTGGGGAGGCCAAGGCAGG - Intergenic
979865166 4:125744935-125744957 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
980115168 4:128672606-128672628 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
980207060 4:129733380-129733402 CACTTTGGGGAGGCCGAGGCGGG + Intergenic
980608707 4:135127513-135127535 CAGACTTGGGAGGCTGAGGCAGG - Intergenic
981193613 4:141892664-141892686 CAGGCTTGGGAGGCTGAGGCAGG - Intergenic
981271627 4:142852279-142852301 CACTTTGGGAAGGCCGAGGCAGG - Intergenic
981429887 4:144646228-144646250 GCGGCGGGGCAGGCGGAGGCAGG - Exonic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
982151094 4:152458262-152458284 CACTTTGGGGAGGCTGAGGCGGG - Intronic
982200330 4:152954099-152954121 CAGTCTGGGAAGGAGGTGGGTGG + Intronic
982224998 4:153156958-153156980 CAGGGTGGGCAGGCAGGGGCGGG - Intronic
982233454 4:153230426-153230448 CACTTTGGGGAGGTGGAGGCAGG - Intronic
982640203 4:157949444-157949466 CACTTTGGGGAGGCCGAGGCGGG + Intergenic
982949073 4:161665351-161665373 TAGTCTGGGGAGGCTGAGGGAGG - Intronic
983581111 4:169310861-169310883 CACTTTTGGGAGGCGGAGGCCGG - Intergenic
983675425 4:170286878-170286900 CTGTCTTGGAAGGCTGAGGCAGG - Intergenic
983843232 4:172482289-172482311 CTCTCTGGGCTGTCGGAGGCTGG - Intronic
984069240 4:175092055-175092077 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
984174443 4:176398756-176398778 CATGCTGGCCAGGCTGAGGCTGG + Intergenic
984805395 4:183746856-183746878 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
984853804 4:184176033-184176055 CATTTTGGGGAGGCTGAGGCAGG - Intronic
984862430 4:184252883-184252905 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
985280312 4:188280014-188280036 AAGTCTGGGCAGGAGGAAGCGGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985622363 5:962371-962393 CAGACAGGGCAGGTGGAGACTGG + Intergenic
985661255 5:1157847-1157869 CAGTGTGGGCAGGTGTGGGCAGG - Intergenic
985961833 5:3308421-3308443 CAGTCTGGGCAGGCCTTAGCTGG - Intergenic
985992873 5:3577919-3577941 CAGTTTGGACAGGTGGAGGCTGG - Intergenic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
986781725 5:11072763-11072785 GTGTCTGGGCAGCCTGAGGCCGG - Intronic
987099133 5:14577212-14577234 CTCTCTGGGCTGGCAGAGGCCGG + Intergenic
987250731 5:16098519-16098541 CACTTTGGGGAGGCAGAGGCAGG + Intronic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
988020568 5:25614972-25614994 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
988079795 5:26401160-26401182 CAGGCTGGGCAAGAGAAGGCAGG + Intergenic
988522414 5:31958498-31958520 CACTTTGGGGAGGCTGAGGCAGG - Intronic
990395501 5:55374533-55374555 CACTCTTGGGAGGCTGAGGCAGG - Intronic
990941829 5:61210198-61210220 CACTTTGGGAAGGCCGAGGCAGG + Intergenic
992050308 5:72935182-72935204 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
992247443 5:74840581-74840603 CACTCTGGGGAGGCCAAGGCGGG + Intronic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
992463952 5:76985780-76985802 GGCTCTGGGCAGGCTGAGGCAGG + Intergenic
992534041 5:77680596-77680618 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
992547467 5:77828122-77828144 CACTTTGGGGAGGCAGAGGCGGG - Intronic
992964497 5:81986007-81986029 CACTTTGGGGAGGCCGAGGCAGG - Intronic
993202252 5:84830696-84830718 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
993338572 5:86692876-86692898 CAGTATGGGGAGGCTGAGGCAGG - Intergenic
993463357 5:88213479-88213501 CAGTCTGGTTAGGTTGAGGCTGG - Intronic
993678648 5:90847875-90847897 CTTTCTGGGCTGGCCGAGGCGGG - Intronic
994127912 5:96190405-96190427 CAGAGTGGGCAGGCAGAGTCAGG - Intergenic
994166967 5:96618455-96618477 CTCTCTGGGCTGGCTGAGGCTGG + Intronic
994210833 5:97085649-97085671 CTGTCTGGGCTGGCCGAGGCTGG - Intergenic
994239818 5:97407126-97407148 CTTTCTGGGCTGGCCGAGGCCGG + Intergenic
994570251 5:101505971-101505993 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
995066727 5:107870829-107870851 CACTTTGGGGAGGCTGAGGCGGG - Intronic
995848862 5:116523423-116523445 CAGACTCGGGAGGCTGAGGCAGG - Intronic
996000234 5:118352796-118352818 GAGACTGGGGAGGCTGAGGCAGG - Intergenic
996298606 5:121954368-121954390 CTCTCTGGGCTGCCGGAGGCCGG - Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996478745 5:123949604-123949626 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
996575942 5:124976515-124976537 CACTCTGGGCTGGCTGAGGCCGG - Intergenic
996747151 5:126854946-126854968 CACTCTGGGCTGGCCGAGGCTGG - Intergenic
996870850 5:128191764-128191786 CAGTTTGGGAAGGAGGTGGCTGG + Intergenic
997248190 5:132369600-132369622 CAGGCTTGGCTGGCAGAGGCCGG + Intergenic
997375452 5:133394297-133394319 CTCTCTGGGCTGGCCGAGGCTGG + Intronic
998791594 5:145771607-145771629 CACTTTGGGGAGGCTGAGGCAGG + Intronic
999044957 5:148457078-148457100 CAGGCTAGGCAGGCAGAGGGGGG - Intronic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
999809528 5:155114786-155114808 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
1000085815 5:157886800-157886822 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1000601869 5:163284723-163284745 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1000853704 5:166372539-166372561 CACTCTTGGGAGGCCGAGGCGGG - Intergenic
1001369754 5:171186780-171186802 CAGTGTTGGGAGGCCGAGGCGGG - Intronic
1001596373 5:172901402-172901424 GAGACTGGGCAGTCAGAGGCTGG - Intronic
1001603973 5:172946935-172946957 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1001975845 5:175997709-175997731 CAGTCTGTACAGGCGGAGCCAGG + Intronic
1002241580 5:177846063-177846085 CAGTCTGTACAGGCGGAGCCAGG - Intergenic
1002294489 5:178222756-178222778 CAGTCAGGACAGGCTGAGGTTGG + Intronic
1002556568 5:180046256-180046278 CTCTCTGGGCTGGCCGAGGCTGG - Intronic
1002612395 5:180429690-180429712 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
1002616391 5:180459118-180459140 CTCTCTGGGCCGGCCGAGGCCGG + Intergenic
1002681658 5:180969793-180969815 CTGTCTGGGCTGGCCGAGGCTGG - Intergenic
1002793157 6:449930-449952 CTCTCTGGGCTGGCGGAGGCCGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003506727 6:6746090-6746112 CTTTCTGGGCTGGCCGAGGCCGG - Intergenic
1004486323 6:16069603-16069625 CTTTCTGGGCAGGCCAAGGCCGG - Intergenic
1004995209 6:21184439-21184461 CACTTTGGGCAGGCCGAGGTGGG - Intronic
1005035620 6:21552700-21552722 CTTTCTGGGCTGGCCGAGGCTGG - Intergenic
1005114324 6:22318820-22318842 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1006007770 6:31016736-31016758 CTCTCTGGGCTGGCCGAGGCCGG + Intronic
1006180380 6:32150505-32150527 CAGTCTGGGCTGGCGCCGGCGGG + Exonic
1006497947 6:34437422-34437444 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1006563138 6:34931123-34931145 CAGCCTTGGGAGGCTGAGGCGGG - Intronic
1006625088 6:35392174-35392196 CAGTCTGGGCAGGCAAAGGCTGG + Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006964987 6:37974308-37974330 CAGTCTGGGGAGGCCGAGGAGGG - Intronic
1007390448 6:41547165-41547187 GAGTGGGGGCAGCCGGAGGCCGG + Intronic
1007836626 6:44678814-44678836 CACTCTGGACAGGCAGGGGCTGG - Intergenic
1008587533 6:52962854-52962876 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1008844791 6:55950254-55950276 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1009739235 6:67722997-67723019 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1010083104 6:71886726-71886748 CAGCCTCGGCCGGCGGGGGCGGG - Intronic
1010147520 6:72688081-72688103 CAGTATTGGGAGGCCGAGGCAGG - Intronic
1010439033 6:75871878-75871900 CACTTTGGGAAGGCTGAGGCAGG + Intronic
1010694376 6:78952172-78952194 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1011004203 6:82625310-82625332 CACTTTGGGGAGGCTGAGGCGGG - Intergenic
1011114657 6:83876943-83876965 CAGACTGGGGAGGCTGAGGCAGG - Intronic
1011129377 6:84037858-84037880 CTCTCTGGGCTGGCCGAGGCTGG - Intronic
1012144975 6:95669986-95670008 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1012377111 6:98575312-98575334 CAGACTAGGGAGGCAGAGGCAGG - Intergenic
1012632497 6:101489431-101489453 CAGTGTGGGCGGGCGGGGGGAGG - Intronic
1012875919 6:104725944-104725966 CACTTTGGGGAGGCTGAGGCGGG + Intergenic
1012933775 6:105344243-105344265 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1012952597 6:105534707-105534729 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1013175172 6:107670346-107670368 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014299647 6:119665624-119665646 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
1014460309 6:121686828-121686850 CTTTCTGGGCAGGCCAAGGCCGG - Intergenic
1014586259 6:123201902-123201924 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1016184642 6:141183460-141183482 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1016508532 6:144813431-144813453 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1016820482 6:148342249-148342271 AAGTCTTGGCTGGCAGAGGCAGG + Intronic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1017537317 6:155362996-155363018 CATTCTGGGCTGGCCAAGGCCGG + Intergenic
1017947973 6:159111304-159111326 CAGACTGGGCAGGCACTGGCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018156785 6:160992194-160992216 CAGTCTCTGCAGGCTGGGGCGGG + Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019219661 6:170463728-170463750 CAGGCTGGGCCGGGGCAGGCAGG - Intergenic
1019294761 7:267856-267878 CATTTTGGGGAGGCTGAGGCAGG - Intergenic
1019324576 7:431952-431974 CAGTCTGGGGAAGCGGGTGCCGG - Intergenic
1019351004 7:553948-553970 CACTGTGGGCAGGGGGAGACAGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019404727 7:877416-877438 GAGTGAGGGCAGGGGGAGGCCGG - Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019485367 7:1286933-1286955 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019618403 7:1977534-1977556 CTCTCTGGGCTGGCCGAGGCCGG - Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019785417 7:2973951-2973973 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1019969308 7:4527400-4527422 CAGCCTTGGGAGGCCGAGGCTGG + Intergenic
1019987377 7:4667541-4667563 CACTTTGGGAAGGCCGAGGCAGG + Intergenic
1020151991 7:5689705-5689727 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1020248685 7:6450106-6450128 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1020248811 7:6450821-6450843 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1020396750 7:7725776-7725798 CAGTCTGGGGAAGAGAAGGCAGG - Intronic
1020914153 7:14170986-14171008 AAGTCTGGGCAGTAGGAGACAGG + Intronic
1021697925 7:23291890-23291912 CCCTCTCGGGAGGCGGAGGCAGG + Intergenic
1021707745 7:23384642-23384664 CACTTTGGGGAGGCAGAGGCAGG + Intronic
1022103713 7:27184119-27184141 CAGGCTGGGGAGCCGGAGGTGGG - Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022361408 7:29663123-29663145 CAGTTTGGTCAGGCAGAAGCAGG + Intergenic
1022699976 7:32750583-32750605 CAGTTTGGACAGGCGGAAGCAGG - Intergenic
1022935923 7:35176308-35176330 CAGTTTGGTCAGGCAGAAGCAGG - Intergenic
1023024584 7:36039069-36039091 CACTCTGGGGAGGCCGAGGTGGG + Intergenic
1023211908 7:37815100-37815122 CATTCTCGGGAGGCTGAGGCAGG - Intronic
1023377947 7:39577387-39577409 CTCTCTGGGCTGGCCGAGGCCGG + Intronic
1023876010 7:44286749-44286771 CAATCGGGGAAGGCGGGGGCAGG + Intronic
1024167856 7:46752403-46752425 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1024276714 7:47683503-47683525 CAGTGTGGGCAGGCTGGTGCGGG + Intergenic
1025021509 7:55484001-55484023 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1025135624 7:56409442-56409464 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026098387 7:67364927-67364949 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1026853426 7:73738488-73738510 GAGTCTGAGCCGGCGGAGACGGG + Intronic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1027191054 7:75995554-75995576 CATTTTGGGGAGGCCGAGGCTGG + Intergenic
1028058789 7:86282570-86282592 CTCTCTGGGCTGGCCGAGGCCGG - Intergenic
1029389145 7:100263323-100263345 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1029442925 7:100597507-100597529 CCATCTTGGCAGGCTGAGGCAGG - Intronic
1029599033 7:101553209-101553231 CAGGCTGGGCAGGCAGGGCCTGG - Intronic
1029650982 7:101891468-101891490 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1029988113 7:104940101-104940123 CTTCCTGGGCTGGCGGAGGCTGG + Intergenic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030168725 7:106580394-106580416 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1030684943 7:112476412-112476434 CACTCTGGGGAGGCTGAGGCGGG + Intronic
1031213394 7:118859064-118859086 CCTTCTGGGCTGGCTGAGGCCGG - Intergenic
1031513364 7:122674246-122674268 CTCTCTGGGCTGGCTGAGGCCGG - Intronic
1031902817 7:127429110-127429132 CTTTCTGGGCTGGCTGAGGCCGG + Intronic
1031938226 7:127758806-127758828 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1031963859 7:128013185-128013207 GACTCTGGACAGGAGGAGGCAGG + Intronic
1032073321 7:128823332-128823354 CACTTTGGGCAGGCTGAGGCAGG - Intergenic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1034241550 7:149615135-149615157 CACTTTGGGGAGGCCGAGGCAGG + Intergenic
1034785711 7:153924351-153924373 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1035246932 7:157568698-157568720 CAGGCTCGGCACGCAGAGGCAGG + Intronic
1035339422 7:158151037-158151059 CAGTGTGGGCAGGCAGGGGCAGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035546205 8:483989-484011 CAGTCAGGCCAGGCTGAGGCCGG + Intergenic
1035571954 8:678561-678583 AAGTCTTGGGAGGCCGAGGCGGG + Intronic
1035813552 8:2513802-2513824 CAGTTTTGGGAGGCTGAGGCAGG + Intergenic
1035873834 8:3165676-3165698 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1035894690 8:3386343-3386365 CACTCTGGGCAGGAGTAGGTGGG - Intronic
1037619896 8:20554593-20554615 CATTGTGGGCAGGCAGAGGGAGG - Intergenic
1037735438 8:21562131-21562153 CACTTTGGGCAAGCTGAGGCGGG - Intergenic
1038024169 8:23574216-23574238 CACTTTGGGGAGGCCGAGGCAGG + Exonic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1038987870 8:32833106-32833128 AAGTGTTGGCAGGCCGAGGCAGG + Intergenic
1039376508 8:37039865-37039887 TAGTCTGGGGAGGTTGAGGCAGG + Intergenic
1039577777 8:38638328-38638350 CAGCCTTGGGAGGCTGAGGCAGG - Intergenic
1039986188 8:42450472-42450494 CAGTTTTGGGAGGCTGAGGCAGG - Intronic
1040630312 8:49202536-49202558 CAGACTCGGGAGGCTGAGGCAGG - Intergenic
1040671319 8:49694560-49694582 CACTCTTGGGAGGCCGAGGCAGG - Intergenic
1040952839 8:52953757-52953779 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1040964632 8:53071554-53071576 CTCTCTGGGCTGGCTGAGGCTGG - Intergenic
1041318911 8:56593712-56593734 GAGTGTGGGCTGGAGGAGGCAGG + Intergenic
1041588319 8:59547065-59547087 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1041623506 8:59999808-59999830 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1042216801 8:66436160-66436182 CACTTTGGGGAGGCTGAGGCTGG - Intronic
1042948805 8:74179933-74179955 CTCTCTGGGCTGGCTGAGGCCGG - Intergenic
1043844869 8:85152617-85152639 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1043923289 8:86008527-86008549 CATTTTGGGGAGGCTGAGGCAGG + Intronic
1044310710 8:90688715-90688737 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1044734700 8:95268199-95268221 CAGTTAGGGGAGGCAGAGGCGGG + Intronic
1044963867 8:97556858-97556880 CTCTCTGGGCAGGCTGAGGCCGG + Intergenic
1044968537 8:97597089-97597111 TATTCTGGGGAGGCTGAGGCGGG - Intergenic
1044975043 8:97656414-97656436 CAGACTCGGGAGGCTGAGGCAGG - Intronic
1045443682 8:102239198-102239220 GAGGCAGGGCAGGCCGAGGCGGG - Intergenic
1045498585 8:102728517-102728539 CAGTCGGGGCAGGCGATGGCTGG - Intergenic
1045933687 8:107655549-107655571 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
1046128643 8:109941335-109941357 CAGTCTGGGGAAGAGAAGGCAGG + Intergenic
1046497719 8:115036652-115036674 CTCTCTGGGCTGGCCGAGGCTGG + Intergenic
1046567742 8:115922292-115922314 CACTTTGGGGAGGCTGAGGCAGG + Intergenic
1046745752 8:117874327-117874349 CACTTTGGGAAGGCTGAGGCAGG + Intronic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049213638 8:141397981-141398003 CAGTCAGCGCAGGCGGAGCAGGG + Intronic
1049275540 8:141718355-141718377 CAGGCAGGGCAGGAGGAGCCTGG - Intergenic
1049461975 8:142734494-142734516 CAGTTTGGGCAGGCTGAGCCAGG + Intronic
1049586696 8:143435701-143435723 CCGGCTGGGCAGTCGGATGCTGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049725300 8:144142931-144142953 CTGGCTGGGGAGGCGGAGGGTGG + Intergenic
1049795584 8:144495993-144496015 CAGTCAGGACAGGAGGAGGCGGG + Intronic
1049944564 9:581191-581213 CTCTCTGGGCTGGCCGAGGCCGG - Intronic
1050705525 9:8392277-8392299 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1051288144 9:15517209-15517231 CAGTTTTGGGAGGCCGAGGCAGG - Intergenic
1051676557 9:19564100-19564122 CAGTTTTGGGAGGCCGAGGCAGG - Intronic
1052106881 9:24529688-24529710 AACTCTGGGCAGGCTGAGGTAGG - Intergenic
1053170065 9:35872057-35872079 GAGTCAGGGGAGGGGGAGGCTGG - Intergenic
1053352016 9:37419432-37419454 GAGTCCCGGAAGGCGGAGGCCGG - Intergenic
1053594489 9:39546031-39546053 CACTCTGGGAAGGCCGAGGAGGG + Intergenic
1053852271 9:42301064-42301086 CACTCTGGGAAGGCCGAGGAGGG + Intergenic
1054571769 9:66818936-66818958 CACTCTGGGAAGGCCGAGGAGGG - Intergenic
1054731268 9:68705002-68705024 CAGTCTGGGCCAGCGGCGGCGGG + Intergenic
1055985555 9:82054749-82054771 CTCTCTGGGCTGGCCGAGGCTGG - Intergenic
1056620999 9:88214521-88214543 CACTTTGGGGAGGCCGAGGCAGG - Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057045882 9:91886119-91886141 CACTTTGGGGAGGCTGAGGCGGG - Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057132195 9:92661845-92661867 CAGGCTGGGCTGGCCGAGGTGGG + Intronic
1057249043 9:93484818-93484840 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1057275784 9:93675420-93675442 GAGTCTGGGCAGGCGGGTGAGGG - Intronic
1057345664 9:94248396-94248418 CACTTTGGGAAGGCTGAGGCAGG - Intergenic
1057442570 9:95092478-95092500 CTGTCTGGGCAGGCGGCCCCAGG - Intergenic
1057601463 9:96461908-96461930 CACTTTGGGGAGGCTGAGGCAGG + Intronic
1057832914 9:98420326-98420348 CAGTCGAGGCCGGCTGAGGCTGG - Intronic
1059129375 9:111729646-111729668 CACTTTGGGAAGGCCGAGGCAGG + Intronic
1059498137 9:114727214-114727236 CAGTGTGTGAAGGCTGAGGCTGG - Intergenic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1060198198 9:121636601-121636623 AAGTCTGGGCAGGAGGTGGCTGG + Intronic
1061308179 9:129744628-129744650 CACTTTGGGGAGGCCGAGGCAGG + Intronic
1061374194 9:130214517-130214539 CTGACTGGGCAGGCTGATGCTGG + Intronic
1061600549 9:131667234-131667256 CACTTTGGGGAGGCCGAGGCAGG - Intronic
1061892224 9:133628945-133628967 GAGTCAGTGCAGGCAGAGGCTGG - Intergenic
1062022330 9:134325619-134325641 CAGGCTGGGCAGGCGCTGCCCGG - Intronic
1062074306 9:134576061-134576083 CAGTCAGGGGAGGCCCAGGCAGG + Intergenic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062464877 9:136676530-136676552 CAGGCTGGGGAGGCGGGGTCAGG - Intronic
1062567308 9:137168938-137168960 CGGTCTCGGCGGGCGGAGGGCGG + Exonic
1062678882 9:137765668-137765690 CAGGCTGGGGCGGCGGGGGCGGG - Intronic
1062718932 9:138024738-138024760 CAGGCTGGGAAGGCTGAGGTGGG - Intronic
1203686709 Un_GL000214v1:1327-1349 AAGTTTGGGCAGGCGGTTGCTGG + Intergenic
1203649566 Un_KI270751v1:102726-102748 AAGTTTGGGCAGGCGGTTGCTGG - Intergenic
1185488919 X:504392-504414 CACTTTGGGGAGGCTGAGGCAGG - Intergenic
1185560328 X:1056000-1056022 CACTTTGGGGAGGCCGAGGCGGG - Intergenic
1185865691 X:3621890-3621912 CACTGTGGGGAGGCCGAGGCGGG + Intronic
1185979906 X:4766954-4766976 CACTTTGGGAAGGCCGAGGCAGG - Intergenic
1186350845 X:8737715-8737737 CAGCCTCGGGAGGCTGAGGCAGG + Intergenic
1186800257 X:13085499-13085521 CATTCTTGGGAGGCCGAGGCAGG - Intergenic
1187050811 X:15694121-15694143 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1187275638 X:17814427-17814449 CAGTCTGGGCAGGAAATGGCAGG + Intronic
1188594740 X:31885362-31885384 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1189695028 X:43654896-43654918 CAGGCCGGGAAGGCGGAGCCAGG + Intronic
1189825890 X:44916890-44916912 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1190042838 X:47085271-47085293 CACTTTGGGAAGGCCGAGGCGGG + Intronic
1190044847 X:47103264-47103286 CACTTTGGGTAGGCCGAGGCGGG + Intergenic
1190454302 X:50611394-50611416 TGGTCTGGGGAGGCCGAGGCGGG - Intronic
1190483290 X:50899006-50899028 CACTTTGGGTAGGCAGAGGCGGG + Intergenic
1191204767 X:57822135-57822157 CAGAGTGGGCTGTCGGAGGCTGG + Intergenic
1192022419 X:67408604-67408626 CTCTCTGGGCTGGCCGAGGCCGG + Intergenic
1192988618 X:76427657-76427679 CAGTCCGCGCAGGCGCAGACTGG - Intergenic
1193130849 X:77918316-77918338 CACTTTGGGGAGGCTGAGGCAGG - Intronic
1194340500 X:92699892-92699914 CTCTCTGGGCTGGCAGAGGCTGG - Intergenic
1195481484 X:105350610-105350632 CTATCTGGGGAGGCTGAGGCAGG + Intronic
1196784582 X:119410640-119410662 CACTTTGGGAGGGCGGAGGCGGG + Intronic
1196792867 X:119480093-119480115 GAGTATGGGCAGGTGGAGTCTGG - Intergenic
1196860917 X:120026203-120026225 CTTTCTGGGCTGGCCGAGGCTGG - Intergenic
1197751179 X:129964666-129964688 CCGTCTCGGGAGGCTGAGGCAGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198057376 X:133008351-133008373 CCTTCTGTGGAGGCGGAGGCAGG - Intergenic
1198256083 X:134925611-134925633 CTCTCTGGGCTGGCTGAGGCCGG + Intergenic
1198630648 X:138634321-138634343 CACTTTGGGGAGGCCGAGGCGGG - Intronic
1198972649 X:142298663-142298685 CTTTCTGGGCTGGCGAAGGCCGG - Intergenic
1199040624 X:143111364-143111386 CAGGCTGGGCAAGAGAAGGCAGG - Intergenic
1199764274 X:150929654-150929676 CTGCCTGGGGAGGCTGAGGCAGG - Intergenic
1200001908 X:153066514-153066536 CAGTCAGAGCAGGCCGCGGCCGG + Intergenic
1200005824 X:153083511-153083533 CAGTCAGAGCAGGCCGCGGCCGG - Intergenic
1200359303 X:155585976-155585998 CACTTTGGGGAGGCCGAGGCGGG + Intronic
1200749447 Y:6931285-6931307 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1200750145 Y:6937455-6937477 CAGTCTCGGAAGACTGAGGCAGG + Intronic
1201424195 Y:13831295-13831317 CTCTCTGGGCTGGCTGAGGCTGG + Intergenic
1201540766 Y:15102675-15102697 CAGTCTGGGGAGGAGGAGAGAGG + Intergenic
1202137157 Y:21677080-21677102 CATTCTGGGCTGGCCAAGGCCGG - Intergenic
1202389286 Y:24353612-24353634 CAGTTTGGGGAGGCCAAGGCAGG - Intergenic
1202481501 Y:25316512-25316534 CAGTTTGGGGAGGCCAAGGCAGG + Intergenic