ID: 1006630549

View in Genome Browser
Species Human (GRCh38)
Location 6:35427188-35427210
Sequence AGCTGGCTCCACGGGAGTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006630537_1006630549 20 Left 1006630537 6:35427145-35427167 CCAGGGCCAGGGCCTGGCCTCAC 0: 1
1: 2
2: 12
3: 80
4: 713
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630541_1006630549 -5 Left 1006630541 6:35427170-35427192 CCCCCTGCTCCTTTCTCTAGCTG 0: 1
1: 1
2: 2
3: 47
4: 507
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630538_1006630549 14 Left 1006630538 6:35427151-35427173 CCAGGGCCTGGCCTCACATCCCC 0: 1
1: 1
2: 1
3: 58
4: 536
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630544_1006630549 -7 Left 1006630544 6:35427172-35427194 CCCTGCTCCTTTCTCTAGCTGGC 0: 1
1: 0
2: 0
3: 29
4: 444
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630540_1006630549 3 Left 1006630540 6:35427162-35427184 CCTCACATCCCCCTGCTCCTTTC 0: 1
1: 1
2: 4
3: 65
4: 701
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630539_1006630549 8 Left 1006630539 6:35427157-35427179 CCTGGCCTCACATCCCCCTGCTC 0: 1
1: 1
2: 4
3: 83
4: 553
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630545_1006630549 -8 Left 1006630545 6:35427173-35427195 CCTGCTCCTTTCTCTAGCTGGCT 0: 1
1: 0
2: 2
3: 35
4: 373
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1006630542_1006630549 -6 Left 1006630542 6:35427171-35427193 CCCCTGCTCCTTTCTCTAGCTGG 0: 1
1: 0
2: 1
3: 36
4: 365
Right 1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006630549 Original CRISPR AGCTGGCTCCACGGGAGTTC AGG Exonic
902604578 1:17561675-17561697 AGCTGGCTCCAGGGCAGGCCAGG - Intronic
903378175 1:22879433-22879455 AGCTGGATCCTCGGCAGTCCAGG + Intronic
903479013 1:23639620-23639642 AGCTGGTGCCAGGGGAGATCAGG - Intronic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
905291118 1:36922436-36922458 TGCTGGCTCATGGGGAGTTCAGG - Intronic
905668255 1:39775302-39775324 AGGGGGCGCAACGGGAGTTCAGG - Intronic
906145075 1:43555491-43555513 AGATGGCACCACGGGACTCCAGG - Intronic
907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG + Intergenic
912501616 1:110126443-110126465 AGCTGGCTACACAGGTGGTCAGG - Intergenic
917479547 1:175400055-175400077 TGCTGGCTCCGGGGGAGTTTTGG + Intronic
920164722 1:204027879-204027901 ATCTGGCTCCCAGGGAGGTCAGG - Intergenic
921166868 1:212514098-212514120 AGCTGCCACCAGGGAAGTTCCGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922609903 1:226918782-226918804 AGCTGGCTGCAGGGGAGTCTGGG - Intronic
1062886515 10:1020723-1020745 AGCTGTGTCCACGGGAGTCCAGG - Intronic
1071476134 10:86026712-86026734 TGCTGGCTCCAGGGTAGGTCTGG - Intronic
1072790000 10:98311095-98311117 AGGTGGCTCCACGGGGGAACTGG + Intergenic
1074821525 10:117182925-117182947 AGCTGGCACCACATGATTTCTGG - Intergenic
1077173866 11:1180104-1180126 GGCAGTCTCCACGGGGGTTCCGG - Intronic
1079443594 11:20539330-20539352 AGCTGGGTCTCCGGGAGTCCAGG - Intergenic
1087620493 11:100536083-100536105 AGGTGGCTCCAAGGGAATCCAGG - Intergenic
1088874688 11:113924704-113924726 GACTGGCTCAACGGGAGTCCTGG - Intronic
1101012796 12:100468404-100468426 AGCTGGCTCCAGGGCAGCACTGG - Intergenic
1104482302 12:129118430-129118452 TCCTGGCTCCAAGGGAGTGCTGG - Intronic
1104571931 12:129933520-129933542 AGCCGTGTCCAGGGGAGTTCTGG - Intergenic
1107040665 13:35944230-35944252 ACCTGGCTCCCAGTGAGTTCAGG - Intronic
1125733064 15:41904973-41904995 AGCTGGCTCCATGAGAGAACAGG + Intronic
1125743788 15:41985652-41985674 AGCTGGCTGCCCGTGAGTTCTGG + Intronic
1127978414 15:64016098-64016120 GGCTGGCTCCAGGGGACTGCAGG + Intronic
1129045330 15:72728961-72728983 GGTTGGCTCCACGGGAGATGAGG + Intronic
1132346283 15:101111068-101111090 AGCTGGTCCCACGGGAGCTGTGG - Intergenic
1132351746 15:101143587-101143609 AGTTGGCTGCACGGCACTTCTGG + Intergenic
1132421292 15:101672387-101672409 AGCTGGATTCACGGGAATACTGG - Intronic
1135108594 16:19672350-19672372 ACCTGGATCCACTGGAGCTCAGG - Intronic
1135584480 16:23658062-23658084 AGGTGGACCCACTGGAGTTCTGG - Intronic
1136428879 16:30185859-30185881 AGCAGGCTCCAGGGGAGGGCAGG - Intronic
1139066700 16:63324483-63324505 AACTGGCTCCACCGGTCTTCTGG + Intergenic
1147993486 17:44349257-44349279 AGCTGGCTCCTCCGGGGTCCAGG - Exonic
1150446435 17:65230245-65230267 GGCTAGCTGCACGGGAGTCCGGG + Intergenic
1151877896 17:76877644-76877666 AGCTGAGGCCACGGGAGCTCTGG - Intronic
1155786775 18:29912593-29912615 AGCTGGCTGCACAGGTGCTCTGG - Intergenic
1160133849 18:76254627-76254649 AACTGGCTCCACTGCATTTCGGG - Intergenic
1163648725 19:18504885-18504907 AGGTGGCTCCTCGGGTGCTCAGG - Intronic
1164528033 19:29026257-29026279 AGGCTGCTCCACGGGAGATCGGG + Intergenic
925304853 2:2840841-2840863 CGGTGGCTCCATGGCAGTTCTGG - Intergenic
926591365 2:14743593-14743615 AGGTGGCTCCAGGAGAGTTCTGG - Intergenic
932970185 2:76531709-76531731 AGCTGGCTCAGCGAGAGCTCTGG + Intergenic
934979680 2:98829517-98829539 AGCTGGCTTCATGGGAGGGCTGG + Intronic
939807889 2:146795904-146795926 ATCTGACTCCAAGGGATTTCAGG - Intergenic
948411232 2:237762915-237762937 GGATGGCTCAAGGGGAGTTCTGG - Exonic
1171457611 20:25280822-25280844 TGCTGCCTCCAGGGAAGTTCTGG - Intronic
1172911754 20:38414757-38414779 AGCTGGCTCCAGGGCAGCACAGG - Intergenic
1175657751 20:60786818-60786840 AGCTGACCGCACGGGAGCTCTGG - Intergenic
1179547953 21:42124940-42124962 GGCAGGGTCCATGGGAGTTCAGG + Intronic
1180134162 21:45850357-45850379 GGCTGGCTCCAGGGGAGAGCTGG - Intronic
1182037485 22:27210653-27210675 AGCTGGCTGCATGGGAATCCGGG - Intergenic
955018145 3:55091523-55091545 AGCTGGTTCTGCAGGAGTTCTGG - Intergenic
960317614 3:116197343-116197365 AGCTGGCTCCATCTGAGTTTTGG - Intronic
966264414 3:178021999-178022021 AGCTGAGTCCACTGGACTTCTGG - Intergenic
966371978 3:179260219-179260241 GGATGGCTCAAGGGGAGTTCTGG + Intronic
966414095 3:179671187-179671209 AGATGGCTCCACTGCATTTCTGG + Intronic
967700926 3:192591525-192591547 ATCTGGTTCCAATGGAGTTCAGG + Intronic
968763061 4:2452228-2452250 AGCTGGCTGCAAGCGAGTGCCGG + Exonic
969080132 4:4611629-4611651 GCCTGGCTCCAAGGGAGTCCGGG - Intergenic
970465961 4:16323343-16323365 AGCTGGCTCCACTGGCATTGTGG + Intergenic
973376664 4:49291657-49291679 AGCTGACTCCACGTGAAATCTGG + Intergenic
973377585 4:49297809-49297831 AGCTGACTCCACGTGAAATCTGG + Intergenic
974631025 4:64489232-64489254 AGCTGGCTTCCTGGAAGTTCAGG - Intergenic
977301642 4:95274288-95274310 GGCTGGCTCCCTGGGATTTCTGG + Intronic
981505819 4:145498569-145498591 AGCTGGGTACAAGGGAGTGCAGG - Intronic
998441305 5:142164730-142164752 AGCTGGCTCCCAGAGAGGTCAGG + Intergenic
1001160120 5:169305426-169305448 GGCTGGATCCAAGGGAGTTCAGG - Intergenic
1001691884 5:173639279-173639301 AGCTGGTCCCCCGGGAGCTCAGG + Intergenic
1002176404 5:177403711-177403733 AGCTTCCTCCCCGGGAGCTCCGG + Intronic
1002308095 5:178296156-178296178 AGCTGCCTCCAGGGAAGCTCAGG + Intronic
1002641513 5:180632825-180632847 AGCAGGCCCCAGGGGAGGTCTGG + Intronic
1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG + Exonic
1008413653 6:51214032-51214054 AGCTGGCTCCCAGGAAGGTCAGG + Intergenic
1012521617 6:100127603-100127625 AGAAGGCTCCACCGGAGTTGAGG + Intergenic
1020016722 7:4835745-4835767 AGCTGGCTGCACAGGAGGGCGGG + Intronic
1026921238 7:74157087-74157109 ATCTGCCTCCACAGGAGTTTCGG - Intergenic
1031141322 7:117946675-117946697 AGCTGACTACACGGGACCTCTGG - Intergenic
1031439995 7:121782361-121782383 GACTGGCTCCACAGGAGCTCCGG - Intergenic
1032528873 7:132603646-132603668 AGCTGGCTCCTGGGGAATGCAGG - Intronic
1038550797 8:28466763-28466785 AGTTGGCTTGACGGGAGTTGTGG + Intronic
1039567349 8:38560848-38560870 AGCTGGCTCCACAGGTGGTAGGG - Intergenic
1051341942 9:16120169-16120191 TGCTGGCACCAGGGGACTTCTGG - Intergenic
1053221701 9:36318067-36318089 AGCTGGCTGCCCTGGAGCTCCGG + Intergenic
1056816171 9:89802840-89802862 AGCTGGCTCCATGTGAGTGACGG + Intergenic
1061802194 9:133118832-133118854 TGCTGGCTGCACGGGTGTTTAGG + Intronic
1061918350 9:133768897-133768919 AGCTGGTTCCACTGGGTTTCTGG - Intronic
1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG + Intronic
1203549738 Un_KI270743v1:157290-157312 AGCTGACTCCACGTGAAATCTGG - Intergenic
1203550680 Un_KI270743v1:163455-163477 AGCTGACTCCACGTGAAATCTGG - Intergenic
1186813983 X:13217337-13217359 ACCTGACTCCAAGGGAGCTCTGG - Intergenic
1187520781 X:20012041-20012063 AGCTGACCCCATGGGAGCTCTGG - Intronic
1190116636 X:47629728-47629750 AGCTGGCCCCAGGGGTGTCCAGG - Intronic
1193439862 X:81526590-81526612 TGCTGGCTTCACAGGAGTTTGGG + Intergenic