ID: 1006632000

View in Genome Browser
Species Human (GRCh38)
Location 6:35436548-35436570
Sequence GAGGGCCCAGCCATGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006632000_1006632015 14 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632000_1006632019 19 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632019 6:35436590-35436612 CCTGGGGCCATGGGATGGGGCGG No data
1006632000_1006632020 20 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632020 6:35436591-35436613 CTGGGGCCATGGGATGGGGCGGG No data
1006632000_1006632004 -4 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632004 6:35436567-35436589 CCTCCATGCCTCCCACCAGCAGG No data
1006632000_1006632006 1 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632006 6:35436572-35436594 ATGCCTCCCACCAGCAGGCCTGG No data
1006632000_1006632013 10 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632013 6:35436581-35436603 ACCAGCAGGCCTGGGGCCATGGG No data
1006632000_1006632017 16 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632017 6:35436587-35436609 AGGCCTGGGGCCATGGGATGGGG No data
1006632000_1006632012 9 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632012 6:35436580-35436602 CACCAGCAGGCCTGGGGCCATGG No data
1006632000_1006632021 25 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632000_1006632008 3 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632008 6:35436574-35436596 GCCTCCCACCAGCAGGCCTGGGG No data
1006632000_1006632007 2 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006632000_1006632016 15 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632016 6:35436586-35436608 CAGGCCTGGGGCCATGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632000 Original CRISPR GAGGGCCCAGCCATGATGGC TGG (reversed) Intergenic
No off target data available for this crispr