ID: 1006632002

View in Genome Browser
Species Human (GRCh38)
Location 6:35436566-35436588
Sequence CTGCTGGTGGGAGGCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006632002_1006632013 -8 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632013 6:35436581-35436603 ACCAGCAGGCCTGGGGCCATGGG No data
1006632002_1006632019 1 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632019 6:35436590-35436612 CCTGGGGCCATGGGATGGGGCGG No data
1006632002_1006632021 7 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632002_1006632017 -2 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632017 6:35436587-35436609 AGGCCTGGGGCCATGGGATGGGG No data
1006632002_1006632020 2 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632020 6:35436591-35436613 CTGGGGCCATGGGATGGGGCGGG No data
1006632002_1006632016 -3 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632016 6:35436586-35436608 CAGGCCTGGGGCCATGGGATGGG No data
1006632002_1006632015 -4 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632002_1006632012 -9 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632012 6:35436580-35436602 CACCAGCAGGCCTGGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632002 Original CRISPR CTGCTGGTGGGAGGCATGGA GGG (reversed) Intergenic
No off target data available for this crispr