ID: 1006632007

View in Genome Browser
Species Human (GRCh38)
Location 6:35436573-35436595
Sequence TGCCTCCCACCAGCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006631999_1006632007 3 Left 1006631999 6:35436547-35436569 CCCAGCCATCATGGCTGGGCCCT No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006632000_1006632007 2 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631998_1006632007 4 Left 1006631998 6:35436546-35436568 CCCCAGCCATCATGGCTGGGCCC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631994_1006632007 11 Left 1006631994 6:35436539-35436561 CCCAGCTCCCCAGCCATCATGGC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631989_1006632007 20 Left 1006631989 6:35436530-35436552 CCCTGAGCCCCCAGCTCCCCAGC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631992_1006632007 12 Left 1006631992 6:35436538-35436560 CCCCAGCTCCCCAGCCATCATGG No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631991_1006632007 13 Left 1006631991 6:35436537-35436559 CCCCCAGCTCCCCAGCCATCATG No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006632001_1006632007 -2 Left 1006632001 6:35436552-35436574 CCATCATGGCTGGGCCCTCCATG No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631995_1006632007 10 Left 1006631995 6:35436540-35436562 CCAGCTCCCCAGCCATCATGGCT No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data
1006631990_1006632007 19 Left 1006631990 6:35436531-35436553 CCTGAGCCCCCAGCTCCCCAGCC No data
Right 1006632007 6:35436573-35436595 TGCCTCCCACCAGCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632007 Original CRISPR TGCCTCCCACCAGCAGGCCT GGG Intergenic
No off target data available for this crispr