ID: 1006632015

View in Genome Browser
Species Human (GRCh38)
Location 6:35436585-35436607
Sequence GCAGGCCTGGGGCCATGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006631998_1006632015 16 Left 1006631998 6:35436546-35436568 CCCCAGCCATCATGGCTGGGCCC No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632005_1006632015 -8 Left 1006632005 6:35436570-35436592 CCATGCCTCCCACCAGCAGGCCT No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632002_1006632015 -4 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006631991_1006632015 25 Left 1006631991 6:35436537-35436559 CCCCCAGCTCCCCAGCCATCATG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006631994_1006632015 23 Left 1006631994 6:35436539-35436561 CCCAGCTCCCCAGCCATCATGGC No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006631999_1006632015 15 Left 1006631999 6:35436547-35436569 CCCAGCCATCATGGCTGGGCCCT No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632000_1006632015 14 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006631992_1006632015 24 Left 1006631992 6:35436538-35436560 CCCCAGCTCCCCAGCCATCATGG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632003_1006632015 -5 Left 1006632003 6:35436567-35436589 CCTCCATGCCTCCCACCAGCAGG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006631995_1006632015 22 Left 1006631995 6:35436540-35436562 CCAGCTCCCCAGCCATCATGGCT No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data
1006632001_1006632015 10 Left 1006632001 6:35436552-35436574 CCATCATGGCTGGGCCCTCCATG No data
Right 1006632015 6:35436585-35436607 GCAGGCCTGGGGCCATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632015 Original CRISPR GCAGGCCTGGGGCCATGGGA TGG Intergenic
No off target data available for this crispr