ID: 1006632021

View in Genome Browser
Species Human (GRCh38)
Location 6:35436596-35436618
Sequence GCCATGGGATGGGGCGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006632005_1006632021 3 Left 1006632005 6:35436570-35436592 CCATGCCTCCCACCAGCAGGCCT No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632003_1006632021 6 Left 1006632003 6:35436567-35436589 CCTCCATGCCTCCCACCAGCAGG No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632000_1006632021 25 Left 1006632000 6:35436548-35436570 CCAGCCATCATGGCTGGGCCCTC No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632014_1006632021 -9 Left 1006632014 6:35436582-35436604 CCAGCAGGCCTGGGGCCATGGGA No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632011_1006632021 -6 Left 1006632011 6:35436579-35436601 CCACCAGCAGGCCTGGGGCCATG No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632010_1006632021 -5 Left 1006632010 6:35436578-35436600 CCCACCAGCAGGCCTGGGGCCAT No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006631998_1006632021 27 Left 1006631998 6:35436546-35436568 CCCCAGCCATCATGGCTGGGCCC No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632002_1006632021 7 Left 1006632002 6:35436566-35436588 CCCTCCATGCCTCCCACCAGCAG No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632001_1006632021 21 Left 1006632001 6:35436552-35436574 CCATCATGGCTGGGCCCTCCATG No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006631999_1006632021 26 Left 1006631999 6:35436547-35436569 CCCAGCCATCATGGCTGGGCCCT No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data
1006632009_1006632021 -2 Left 1006632009 6:35436575-35436597 CCTCCCACCAGCAGGCCTGGGGC No data
Right 1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632021 Original CRISPR GCCATGGGATGGGGCGGGCC TGG Intergenic
No off target data available for this crispr