ID: 1006632024

View in Genome Browser
Species Human (GRCh38)
Location 6:35436620-35436642
Sequence TGCAAATCGCCTCCTCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006632005_1006632024 27 Left 1006632005 6:35436570-35436592 CCATGCCTCCCACCAGCAGGCCT No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632010_1006632024 19 Left 1006632010 6:35436578-35436600 CCCACCAGCAGGCCTGGGGCCAT No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632022_1006632024 0 Left 1006632022 6:35436597-35436619 CCATGGGATGGGGCGGGCCTGGC No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632014_1006632024 15 Left 1006632014 6:35436582-35436604 CCAGCAGGCCTGGGGCCATGGGA No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632018_1006632024 7 Left 1006632018 6:35436590-35436612 CCTGGGGCCATGGGATGGGGCGG No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632003_1006632024 30 Left 1006632003 6:35436567-35436589 CCTCCATGCCTCCCACCAGCAGG No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632009_1006632024 22 Left 1006632009 6:35436575-35436597 CCTCCCACCAGCAGGCCTGGGGC No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data
1006632011_1006632024 18 Left 1006632011 6:35436579-35436601 CCACCAGCAGGCCTGGGGCCATG No data
Right 1006632024 6:35436620-35436642 TGCAAATCGCCTCCTCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006632024 Original CRISPR TGCAAATCGCCTCCTCCCTT TGG Intergenic
No off target data available for this crispr