ID: 1006634535

View in Genome Browser
Species Human (GRCh38)
Location 6:35452533-35452555
Sequence GTGTCGCCATGCCGGGGCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006634535_1006634550 10 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634550 6:35452566-35452588 GCTCCCTGGGGCTGAGGGCGTGG 0: 1
1: 1
2: 5
3: 97
4: 879
1006634535_1006634554 24 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634535_1006634544 -4 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634544 6:35452552-35452574 ACACCGGACGCGGGGCTCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 70
1006634535_1006634549 5 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634549 6:35452561-35452583 GCGGGGCTCCCTGGGGCTGAGGG 0: 1
1: 0
2: 1
3: 54
4: 522
1006634535_1006634548 4 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634548 6:35452560-35452582 CGCGGGGCTCCCTGGGGCTGAGG 0: 1
1: 1
2: 6
3: 70
4: 555
1006634535_1006634546 -2 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634546 6:35452554-35452576 ACCGGACGCGGGGCTCCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 124
1006634535_1006634555 25 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634555 6:35452581-35452603 GGGCGTGGAGCCGGCGCCCTGGG 0: 1
1: 0
2: 3
3: 15
4: 239
1006634535_1006634545 -3 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634545 6:35452553-35452575 CACCGGACGCGGGGCTCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 92
1006634535_1006634553 16 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634553 6:35452572-35452594 TGGGGCTGAGGGCGTGGAGCCGG 0: 1
1: 0
2: 6
3: 69
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006634535 Original CRISPR GTGTCGCCATGCCGGGGCAC GGG (reversed) Exonic
900171193 1:1269751-1269773 GTGTGGCCATGGCTGGGCGCGGG - Intronic
900978077 1:6029574-6029596 GTGACACCAGGGCGGGGCACAGG + Intronic
901772336 1:11536770-11536792 GTGTCCCCAGGCCTGGGCCCAGG + Exonic
902616381 1:17625752-17625774 GCGCGGCCATGCAGGGGCACTGG + Intronic
903859053 1:26354273-26354295 CTGTCACCCTGCTGGGGCACAGG - Intergenic
905403941 1:37720844-37720866 GTGTTCCCATCCCTGGGCACAGG - Exonic
907298424 1:53470288-53470310 GCGGCGCCCTGCCAGGGCACCGG - Intergenic
914022825 1:143885093-143885115 GTGGCGCCGCGCCGGGGCCCGGG - Intergenic
914661312 1:149793037-149793059 GTGGCGCCGCGCCGGGGCCCGGG - Intronic
915127985 1:153679101-153679123 CTGAGGCCATGCCGGGGCCCCGG + Exonic
1066022928 10:31320111-31320133 GAGTCCCCAGGCCGGGGCTCTGG - Intronic
1068314150 10:55320004-55320026 GTGTGGCCAGGCTGGGGCCCTGG - Intronic
1069334148 10:67328324-67328346 GTGTAGCCAGGCTGGGGCTCTGG + Intronic
1069474613 10:68721524-68721546 GCGTCGCCATGCCGAGGCTGAGG - Intronic
1069620985 10:69837057-69837079 GGGTCTCCATGCCAGGGCTCCGG + Intronic
1069876599 10:71566939-71566961 GAGTCTCCATGCTGGGGCCCCGG + Intronic
1076818813 10:132928004-132928026 GTGTCCTCAAGCCGGGGCAGAGG + Intronic
1077327763 11:1971088-1971110 CTGTGGCCAGGCCGGGGCCCCGG - Intronic
1091401350 12:182480-182502 GTGCAGCCCTGCAGGGGCACGGG - Intergenic
1096304590 12:50463297-50463319 GAGTCGCCATGCCTGGCCAAAGG - Intronic
1096706227 12:53424114-53424136 GTGTCCCCATGGCAGGGCTCAGG + Intronic
1098155136 12:67589760-67589782 GTGCAGCCATGGCTGGGCACGGG + Intergenic
1102570041 12:113821890-113821912 GTGTTGCCTTGCCTGGGCTCTGG + Intronic
1102584317 12:113912461-113912483 GTGGCTCCAAGCCGGGGCTCTGG + Intronic
1113333570 13:109356044-109356066 CTGGCACCATGGCGGGGCACGGG + Intergenic
1114059100 14:19002631-19002653 GTGTGGCCAGGCTGGGGCCCTGG - Intergenic
1114103443 14:19399123-19399145 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1120562283 14:86009995-86010017 GTGTCATCTTGCCTGGGCACAGG - Intergenic
1121263428 14:92583061-92583083 GTGCCGCCATCACAGGGCACTGG + Intronic
1122789442 14:104178193-104178215 AGGTCGCCAGGCTGGGGCACTGG + Intronic
1122836734 14:104434336-104434358 GTGGCGACAAGCAGGGGCACAGG - Intergenic
1123137135 14:106038336-106038358 GTGTGTCCATGGTGGGGCACAGG + Intergenic
1123163384 14:106301829-106301851 GTGTGTCCATGGTGGGGCACAGG + Intergenic
1132886299 16:2183709-2183731 GTGTCACCAAGCCGGGCCACCGG - Exonic
1132973326 16:2699530-2699552 GTGTCGTCATGTCGAGCCACAGG + Intronic
1136037316 16:27550020-27550042 GTGACGTCATGCCGGCGCGCTGG - Intergenic
1140263382 16:73399691-73399713 TTGTCTCCATGCTGGGGGACTGG + Intergenic
1141920234 16:87130731-87130753 GTGGTGCCAGGCCTGGGCACTGG - Intronic
1151665448 17:75542905-75542927 GTGACTCCAGGCCAGGGCACCGG - Intronic
1152567600 17:81107116-81107138 GTGTCGGCATGCTGGGGCTGGGG + Intronic
1153954330 18:10083370-10083392 CTGTAGCCATGCCTGGGCTCAGG - Intergenic
1156332034 18:36131461-36131483 GTTCCGCCATGGCTGGGCACTGG + Intronic
1161201904 19:3019662-3019684 GTCTCCCCATGGCGGGGCAGGGG + Intronic
1161626123 19:5327883-5327905 GAGTCACCATGCCCGGGTACTGG + Intronic
1162486113 19:10961351-10961373 GTGTCGCGAGGCCGTGGCAGCGG + Intronic
1163686757 19:18716118-18716140 GGGTCCCCAGGGCGGGGCACTGG - Intronic
1165421757 19:35725542-35725564 GTGTCGTGATGCTGGGGCAGGGG - Exonic
926141482 2:10370995-10371017 CTGGCTCCATGCCGGGTCACTGG - Intronic
941709576 2:168698005-168698027 GAGTCACCATGCCTGGCCACAGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943093825 2:183404974-183404996 GTGTAGCCAGGCTGGGGCCCCGG + Intergenic
945315087 2:208361873-208361895 GTGTCACCTTGACGGGGCAAAGG + Intronic
1178724306 21:35037444-35037466 GTGGCACCAAGCTGGGGCACTGG - Intronic
1179544816 21:42106925-42106947 CTGTCGCCATGCACAGGCACTGG - Intronic
1180477584 22:15725247-15725269 GTGTGGCCAGGCTGGGGCCCTGG - Intergenic
1183614491 22:38935213-38935235 GTGTGGCCATGCCAGGGCTGCGG + Intergenic
954391414 3:50269854-50269876 GTGTCTCCAGGCGGGCGCACTGG - Intronic
956740268 3:72270251-72270273 GTGACGACATCCCGGGCCACTGG + Intergenic
960901770 3:122561172-122561194 GAGCCGCCATGCCTGGCCACTGG - Intronic
962291843 3:134144169-134144191 GTGTCCCCATGGCAGTGCACAGG - Intronic
962335648 3:134527778-134527800 GTGTGGCCAGGCTGGGGCCCTGG + Intronic
965971485 3:174561482-174561504 GAGCCACCATGCCGGGCCACAGG + Intronic
982151063 4:152458057-152458079 CTGTTGCCATGCCAGTGCACTGG + Intronic
984856302 4:184198978-184199000 GTGTCTCCTTGCAGGGGCTCTGG + Intronic
987558762 5:19490442-19490464 CTGTCACCAGGCTGGGGCACTGG + Intronic
1002259186 5:177982324-177982346 GTGTCGCCAGGGCGGGGCCCTGG - Intergenic
1003538473 6:6997146-6997168 CTGTCGCCATGGAGGGGCATGGG + Intergenic
1006634535 6:35452533-35452555 GTGTCGCCATGCCGGGGCACGGG - Exonic
1012041900 6:94216485-94216507 GTGTCCCCAAGACGGGACACGGG - Intergenic
1018013850 6:159694652-159694674 GTGTCGCGATGTCGGCTCACTGG + Intronic
1018331016 6:162727600-162727622 GTGGCGCCATACCGGGGCGTGGG + Intronic
1019386113 7:757142-757164 GTGCCGCCAGGCCGGGCCATCGG + Intronic
1019730345 7:2626346-2626368 GAGTCGCCATGCCTGGCCTCAGG + Intergenic
1027765731 7:82339088-82339110 GTTTCTCCATGCCTGGGCGCAGG - Intronic
1037304128 8:17487142-17487164 TTTTCGCCATGCCGGGCCAGAGG + Intergenic
1037373623 8:18205843-18205865 GTGTGGCCAGGCTGGGGCCCTGG + Intronic
1040087940 8:43365235-43365257 GTGTGGCCAGGCTGGGGCCCTGG - Intergenic
1040088178 8:43366818-43366840 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1040404291 8:47085299-47085321 GTGTGGCCAGGCTGGGGCCCTGG - Intergenic
1040404472 8:47086572-47086594 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1046895065 8:119463449-119463471 GTGTGGCCAGGCTGGGGCCCCGG - Intergenic
1049210461 8:141384166-141384188 GTGTCGCCTTGTCCTGGCACAGG + Intergenic
1049507117 8:143008709-143008731 GCGTGGCCAGGCCGGGGCCCTGG + Intergenic
1057990733 9:99766982-99767004 GTGCCTTCAAGCCGGGGCACTGG + Intergenic
1062684537 9:137803699-137803721 GTGTCACCATGCCTGGCTACTGG - Intronic
1186329620 X:8518264-8518286 GTCTCTCCATGGCGGGGCGCTGG + Intergenic
1188743839 X:33817488-33817510 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1189940699 X:46117711-46117733 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1190116022 X:47626832-47626854 GGGCCCCCATGCTGGGGCACAGG + Exonic
1194244997 X:91500145-91500167 GGGTGGCCAGGCAGGGGCACTGG - Intergenic
1195346365 X:103954326-103954348 GTGTGGCCAGGCTGGGGCCCTGG - Intronic
1195361090 X:104084518-104084540 GTGTGGCCAGGCTGGGGCCCTGG + Intergenic
1200563972 Y:4741455-4741477 GGGTGGCCAGGCAGGGGCACTGG - Intergenic