ID: 1006634554

View in Genome Browser
Species Human (GRCh38)
Location 6:35452580-35452602
Sequence AGGGCGTGGAGCCGGCGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006634538_1006634554 18 Left 1006634538 6:35452539-35452561 CCCCGGCATGGCGACACCGGACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634536_1006634554 23 Left 1006634536 6:35452534-35452556 CCGTGCCCCGGCATGGCGACACC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634535_1006634554 24 Left 1006634535 6:35452533-35452555 CCCGTGCCCCGGCATGGCGACAC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634539_1006634554 17 Left 1006634539 6:35452540-35452562 CCCGGCATGGCGACACCGGACGC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634547_1006634554 2 Left 1006634547 6:35452555-35452577 CCGGACGCGGGGCTCCCTGGGGC 0: 1
1: 0
2: 5
3: 29
4: 238
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242
1006634540_1006634554 16 Left 1006634540 6:35452541-35452563 CCGGCATGGCGACACCGGACGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 22
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006634554 Original CRISPR AGGGCGTGGAGCCGGCGCCC TGG Exonic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900299515 1:1969823-1969845 AGGGCCAGGAGCCCCCGCCCAGG + Intronic
900547680 1:3237604-3237626 GGGGTGTGGAGCCTGCTCCCGGG + Intronic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
902402997 1:16167989-16168011 GGGGCGGGGAGGCGGCGGCCCGG + Intergenic
902478815 1:16701248-16701270 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
902920666 1:19664768-19664790 AGGGCGGGGTCCCGGCACCCCGG - Intergenic
903033813 1:20481622-20481644 AGGTCGTGGAGCAGGCCCCTGGG - Intergenic
903170090 1:21547363-21547385 AGGGCGTGGTGGCTGCTCCCAGG + Intronic
903792645 1:25905735-25905757 AGGGGGTGGTGGCGGCGGCCTGG - Intronic
903875958 1:26472971-26472993 AGGGCGGGAAGGCGGCGCTCGGG + Intronic
904768964 1:32870618-32870640 GGGGCGGGGGGCCGGCGCCGGGG - Intronic
905819722 1:40979997-40980019 CGGGAGTGGGGCGGGCGCCCCGG + Intronic
907278160 1:53328190-53328212 AGGGCGAGGAGGCGGCGGCAGGG - Intergenic
907430001 1:54406168-54406190 AGAGCGCGGAGCCAGCGCCTGGG - Exonic
911094896 1:94047147-94047169 AGGGCCTGGAGACAGAGCCCTGG - Intronic
912337559 1:108876961-108876983 AGCGCCTGGAGCCGGGGCGCAGG + Exonic
914902359 1:151717485-151717507 AGGCCGCGGAGGCGGCGCCGCGG + Intronic
914937584 1:151993962-151993984 AGGGCGTGGGCCGCGCGCCCGGG - Exonic
915247608 1:154567769-154567791 AGGGGGAGGAGTCTGCGCCCCGG - Exonic
915446789 1:155978634-155978656 AGGGCGGGGTGCCCGCGCGCAGG + Intronic
915555121 1:156656972-156656994 AGTGCTTGTAGCAGGCGCCCTGG - Exonic
915572210 1:156750947-156750969 AGGGGGTGGCGGCGGCGCCTGGG + Intronic
918064275 1:181089114-181089136 AGCCCGGGGAGCCGGCGGCCGGG + Exonic
922539405 1:226407764-226407786 GGGGCGGGGACGCGGCGCCCCGG - Intronic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065189228 10:23195138-23195160 AGGGCCCAGTGCCGGCGCCCCGG - Intergenic
1068080051 10:52308875-52308897 AGGGCGCGGGGCCTGCGCGCTGG + Intergenic
1069857924 10:71451881-71451903 AGGGCATGGAGCCAGCCCCCGGG - Intronic
1071966470 10:90857690-90857712 TGCCCATGGAGCCGGCGCCCCGG + Exonic
1076116902 10:127907232-127907254 AGGGCGGCGGGCAGGCGCCCGGG + Exonic
1076329526 10:129654291-129654313 AGGGCGTGGAGCAGGTGCCCAGG + Intronic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1077057999 11:605325-605347 AGGGAGAGGAGCGGGTGCCCAGG - Intronic
1077060819 11:617225-617247 ATGGCGTGGGGCAGGCGCGCGGG - Exonic
1077081566 11:726761-726783 GGGGCGTGGCGCCGGAGCGCAGG - Intronic
1077409180 11:2395539-2395561 AGGGCGGGGAGCAGGGCCCCGGG + Intronic
1078631562 11:13009037-13009059 AGGGAGTGGAGCCCGCGCCTCGG - Intergenic
1081486824 11:43537427-43537449 AGGACGTGGAGCTGCCGCCGAGG - Intergenic
1081866283 11:46362242-46362264 AGGGTGTGGAGTGGGCGCTCTGG + Intronic
1082807144 11:57458611-57458633 AGGGCCTGGAGGCGGCGGCGGGG - Intergenic
1083430835 11:62612889-62612911 AGGGCCTGGAGCCGGAGGCCGGG - Exonic
1083674122 11:64316098-64316120 AGGGCGTGGGGCCTGTTCCCAGG - Exonic
1083921077 11:65781528-65781550 GGGGCGAGGAGCCGGCGCCGCGG + Intergenic
1084284331 11:68121580-68121602 GGGGCGTCGAGGGGGCGCCCCGG + Intergenic
1085332897 11:75668027-75668049 CGGAGGTGGAGCCGGAGCCCAGG + Exonic
1086888219 11:92226677-92226699 AGGGAGTGGCGCCTGCGGCCCGG + Intergenic
1090616831 11:128522457-128522479 AGGGCGGGGAGCCGGGGGCGGGG + Intronic
1090650873 11:128804775-128804797 AGGGACTGGAGTCGGCCCCCAGG + Intronic
1096121442 12:49091782-49091804 AGGGAGGGGAGCCGGTGCCTGGG - Intronic
1096842712 12:54389344-54389366 TGGGGGTGGGGCCGGAGCCCTGG + Intronic
1098550325 12:71754996-71755018 AGGGCGTGGGGACAGCGCCCGGG + Exonic
1099202357 12:79690901-79690923 AGGGCTGGGATCCGGCTCCCAGG + Exonic
1103480710 12:121248295-121248317 AGGGTTGGGAGCCGGAGCCCAGG - Intronic
1103623582 12:122203512-122203534 CGGGTGTGGCGCCGGCGTCCTGG + Intergenic
1104594742 12:130113451-130113473 AGGGTGTGGGGCTGGCACCCGGG - Intergenic
1104977830 12:132560148-132560170 CGGGCGTGGAGCGCGAGCCCCGG - Intronic
1105344304 13:19559859-19559881 AGGGAGTGGGGCCTGCTCCCAGG + Intergenic
1105535730 13:21261715-21261737 AGGGAGTGGGGCCTGCTCCCAGG - Intergenic
1106308397 13:28532832-28532854 AGGGCGGGGAGGTGGCGCTCGGG - Intergenic
1108695959 13:52902598-52902620 AGGGCCTGGAGCTGGTACCCAGG + Intergenic
1112505023 13:99970385-99970407 AGGGCTTGGCGCCGCCGGCCGGG + Exonic
1112768610 13:102773009-102773031 AGCCGGTGGAGCCGGCGCTCCGG - Intronic
1113591716 13:111506195-111506217 AGGGCGTGGAGCTGTGGCCCTGG + Intergenic
1113774450 13:112934840-112934862 AGGGAGTGGCGGGGGCGCCCAGG - Intronic
1115592207 14:34874951-34874973 CGGGCGAGGAGCCGGCGCTGGGG - Intronic
1116426609 14:44798939-44798961 AGGGCGGGGAGGCGGCGGCGGGG - Intergenic
1118471223 14:66077039-66077061 AGGGCTTGGAGCTGGGGCTCAGG - Intergenic
1118837018 14:69484761-69484783 AGGGCGCGTAGCCGGCGGCTTGG - Exonic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1122436805 14:101706264-101706286 AGGCCGTGGCGGCGCCGCCCCGG + Intergenic
1122716728 14:103700602-103700624 AGGGCGTGCAGGCGGCCCTCAGG - Intronic
1122967214 14:105136986-105137008 AGGGCCTGGAGCCGGGGACGGGG - Intergenic
1124363047 15:29053085-29053107 AGGGCCTGGACCCAGTGCCCAGG - Intronic
1124374308 15:29120858-29120880 ATGCCGTGGAGCCGGGGCCAAGG + Exonic
1124477077 15:30044695-30044717 AGGGCGGGAAGGCGGGGCCCGGG - Intergenic
1128147090 15:65337738-65337760 AGGGAGTGGAGAGGGCACCCAGG + Intronic
1129451086 15:75651747-75651769 AGGGCGTGGAGCTGGCTCCCTGG + Intronic
1130411756 15:83653930-83653952 AGGGCGCGGTGCCGGCGCGCAGG + Intergenic
1131161007 15:90104776-90104798 CTGGCGTGGAGCTGGGGCCCTGG - Intergenic
1132315521 15:100887626-100887648 AGGGCATCCAGCCGGCGCCATGG - Exonic
1132607805 16:800796-800818 AGGGTGTGGGGGCGGCGCCAGGG - Intergenic
1136269428 16:29139709-29139731 GGGGCGTGGAGCCAGGGCACGGG + Intergenic
1136548606 16:30969470-30969492 TCGGCCAGGAGCCGGCGCCCGGG - Intronic
1138105214 16:54284350-54284372 AGCGCTCGGTGCCGGCGCCCAGG + Intronic
1139448520 16:67013498-67013520 AGGGTGTGGAGCCGGGGCTGTGG - Intergenic
1141538335 16:84699492-84699514 AAGGCGTGGCCCAGGCGCCCAGG + Intergenic
1142072906 16:88100979-88101001 GGGGCGTGGAGCCGGGGCACGGG + Intronic
1142155710 16:88532090-88532112 CGGCCGGGGAGCCGGTGCCCTGG - Exonic
1143023958 17:3930173-3930195 AGGGCCTGGAGCTGGGGCCGAGG - Intronic
1143023989 17:3930265-3930287 AGGGCCTGGAGCTGGGGCCGAGG - Intronic
1143038496 17:4015261-4015283 AGGGAGTGGGGCTGGAGCCCAGG + Intronic
1144547862 17:16215016-16215038 AGAGCGGGCAGCCGGTGCCCCGG - Intronic
1144702637 17:17349046-17349068 AGGGCGTGGAGCAGGTGGACAGG - Intergenic
1146183723 17:30711988-30712010 TGGGGGTGTAGCTGGCGCCCAGG + Intergenic
1146935127 17:36808435-36808457 AGCGCGCGGCGCCGGCGCCCTGG - Intergenic
1148698656 17:49575741-49575763 AGCGCGGGGAGCGGGCGGCCGGG + Intergenic
1148698987 17:49576885-49576907 AAGCCGCGGAGCCGGCGCACGGG - Intronic
1152077588 17:78168859-78168881 AGGGCGGGAAGGCGGGGCCCGGG - Intronic
1152388416 17:79988907-79988929 AGGGCCTGGGGCCGGCGGGCAGG - Intronic
1152861203 17:82697965-82697987 AGCGCGGCGAGCAGGCGCCCAGG - Intronic
1152923837 17:83078979-83079001 AGGACGTGCAGCCGCCGCGCCGG - Intergenic
1153620684 18:6974961-6974983 AGCGTGTGGACCCGGAGCCCAGG + Exonic
1158453386 18:57586475-57586497 AGAGCGGGCAGCTGGCGCCCGGG - Intronic
1160527941 18:79548194-79548216 AGGGCTGGGAGCCCGGGCCCAGG - Intergenic
1160832242 19:1109433-1109455 GGGGCGTTGAGGCCGCGCCCCGG + Intronic
1160849449 19:1183432-1183454 AGGGAGGGGAGACGGCCCCCAGG + Intronic
1161031845 19:2061318-2061340 AGGAGGAGGAGGCGGCGCCCGGG - Intergenic
1161114586 19:2489400-2489422 GGGGCGTGGGGCGGGCGGCCGGG - Intergenic
1161737882 19:6002677-6002699 AGGGCGGGAAGCCCGGGCCCTGG + Intronic
1162810703 19:13163079-13163101 AGCGCGCGGAGACGGAGCCCGGG - Intergenic
1162893049 19:13747869-13747891 GGGGCGCGGAGAGGGCGCCCAGG + Intronic
1162975074 19:14203765-14203787 TGGGGGTGTAGCTGGCGCCCAGG - Intronic
1163693489 19:18750473-18750495 CGGGCGTGGAGGCGGCACCCTGG + Intronic
1164671325 19:30073733-30073755 AGGGCATGGAGCCGCAGCTCCGG + Intergenic
1164907456 19:31978755-31978777 AGGGCCTGGGGCAGGCACCCAGG - Intergenic
1165784123 19:38451194-38451216 AGGGCGTAGAGACGGGGCCTGGG + Intronic
1166559096 19:43720092-43720114 AGGCAGGGGAGCCGGCGTCCTGG + Intergenic
1167859252 19:52269911-52269933 AGGGCGTGGATCCGCCTCGCAGG - Intronic
1202712834 1_KI270714v1_random:27079-27101 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
925893947 2:8457175-8457197 CGGGCGTGGAGGCCGCTCCCGGG + Intergenic
927645356 2:24873766-24873788 AGGGCATGGAGCTGGCGCCAGGG - Intronic
932599256 2:73112742-73112764 GGGGCGCGGAGCCGGCGGCGGGG - Exonic
932621831 2:73269340-73269362 AGGGCAAGGAGCAGGCGGCCGGG - Exonic
932771484 2:74503060-74503082 CGGGGGTGCAGACGGCGCCCTGG + Intronic
934746071 2:96760696-96760718 AGGGCGCGGAGGCGGAGCACTGG + Intergenic
934921422 2:98347590-98347612 AGGACCTGGAGCCGGCGCCCCGG + Intronic
938140653 2:128791884-128791906 CGGGTGTGGAGCGGGAGCCCAGG + Intergenic
938962321 2:136354777-136354799 AGGGCTGGGAGCCGGGGCCTAGG - Intergenic
940954355 2:159712163-159712185 TGGGCGGGGACCCGGCGCCCGGG + Intergenic
943725223 2:191245687-191245709 AAGGCGCGGAGCAGGCGCCTCGG - Intronic
945080954 2:206085729-206085751 GGTGAGTGGGGCCGGCGCCCGGG - Intronic
946304443 2:218847701-218847723 AGGGCAAGGAGCCGGGTCCCAGG - Intergenic
946395627 2:219442424-219442446 CGGGCGGGGGGCCGGGGCCCGGG - Intronic
946418690 2:219552978-219553000 AGGGCCTGGAGCCGGAGCCGCGG + Exonic
947743044 2:232493641-232493663 AGGGCGTGCAGCCGGGACCTTGG + Intergenic
948560378 2:238847847-238847869 CGGGCGAGGACCCGGCCCCCGGG + Intergenic
1168750740 20:279392-279414 AGCCCGTGGACCCGCCGCCCCGG + Intronic
1169143672 20:3239322-3239344 AGGGCGCGGGGCGGGCGGCCGGG - Intergenic
1169863032 20:10172200-10172222 AGGTCGGGGAGCCAGAGCCCAGG + Intergenic
1171201305 20:23244639-23244661 ACAGAGTGGCGCCGGCGCCCTGG + Intergenic
1172474603 20:35227085-35227107 AGGTCGCGGAGGCGGCGCGCCGG + Intronic
1172661997 20:36574299-36574321 GGCGCGTGGGGCCGGCGCCCCGG + Intronic
1175625330 20:60484552-60484574 AGGGCTTGGAGGGGGAGCCCTGG - Intergenic
1176077131 20:63253778-63253800 AGGGGCTGGAGCCGATGCCCGGG - Intronic
1176085961 20:63295628-63295650 AGGACGTGGTGCTGTCGCCCAGG - Intronic
1176129065 20:63488588-63488610 AGACCGTGGAGCAGCCGCCCAGG - Intronic
1176135721 20:63521199-63521221 AGCGGGTGGAGCCGCCGCGCTGG - Intronic
1176240329 20:64072943-64072965 AGGGCGTGGAGCTCATGCCCCGG + Intergenic
1176307910 21:5133909-5133931 AGGCCCTGGAGGCGGTGCCCAGG - Exonic
1179025461 21:37675568-37675590 AGGGCGATGCGGCGGCGCCCAGG - Intronic
1179783992 21:43719489-43719511 AGAGCCTGGCGCGGGCGCCCTGG + Intronic
1179849151 21:44128121-44128143 AGGCCCTGGAGGCGGTGCCCAGG + Exonic
1179887896 21:44322241-44322263 AGGGCCTGGATACTGCGCCCTGG - Intronic
1180801609 22:18634547-18634569 CGGGCCTGGAGGCGGCGACCAGG - Intergenic
1180852853 22:19030086-19030108 CGGGCCTGGAGGCGGCGACCAGG - Intergenic
1180933265 22:19607628-19607650 AGGGCGTGCAGCCTGCTGCCTGG + Intergenic
1181053495 22:20248629-20248651 AGGCCGAGGAGCCGGGTCCCAGG + Intronic
1181220113 22:21360714-21360736 CGGGCCTGGAGGCGGCGACCAGG + Intergenic
1181644820 22:24225552-24225574 AGGGGGTGGTGCCGGAACCCCGG + Exonic
1181775914 22:25160209-25160231 AGGGAGTGGAGCCGGAGCTGAGG + Intronic
1182623599 22:31630778-31630800 AGTGAGCGGAGCCGGCGCCCCGG - Intronic
1183391076 22:37546015-37546037 AGGGCGTTGAGCCAGCTCCCGGG - Intergenic
1183409677 22:37647451-37647473 AGGGCCTGCAGCCGGGCCCCTGG - Exonic
1183663697 22:39235496-39235518 AGGGCGGGGAGAAGGTGCCCAGG - Intronic
1183883519 22:40856984-40857006 AGGGCGTGGAGCCGGAGGGTCGG + Exonic
1185029518 22:48434340-48434362 AGGGCAGGGAGGCGGAGCCCCGG + Intergenic
949806332 3:7959482-7959504 AGGGTGTGGAGCCCTCGCCAGGG + Intergenic
950715022 3:14841865-14841887 AGGGCCTGGACCCTGCACCCTGG - Intronic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952884983 3:38006675-38006697 AGGGCGTGGACCCTGCCCGCAGG + Exonic
954129375 3:48552306-48552328 AGGGCATGGAGGCGGTGGCCTGG + Intronic
954275650 3:49540022-49540044 AGGCCGTGGGGCCGGCGGGCGGG + Intergenic
954435883 3:50495793-50495815 TGGGCGTGGAGCCTGGGCTCAGG - Intronic
954612824 3:51955313-51955335 AGGGCCTGGCGCCAGCCCCCTGG - Exonic
954881131 3:53836612-53836634 AGGGCGTGGAGCCCTCAGCCAGG - Intronic
956761193 3:72446870-72446892 AGGCGGTGGCGGCGGCGCCCCGG + Exonic
960613889 3:119579797-119579819 CGGGCGTGGCGCGGGCTCCCGGG - Exonic
961112430 3:124296478-124296500 AGGGCGAGGACCCGGAGTCCTGG - Intronic
961332941 3:126153696-126153718 TGGGCTTTGAGCCGGCTCCCAGG - Intronic
961574480 3:127823286-127823308 GGCGCGGGGAGGCGGCGCCCGGG + Intergenic
961580239 3:127875012-127875034 AGGGCCTGGAGAGGGAGCCCAGG + Intergenic
961688307 3:128650608-128650630 GGGACGTGGAGCCGCCGCCCAGG + Exonic
962288352 3:134107283-134107305 AGGCCATGGAGCTGGTGCCCTGG - Intronic
964620261 3:158714185-158714207 AGGGCGTGGAGCAGGCACTGAGG - Intronic
966320777 3:178699176-178699198 AGGGCATGGAGAAGGCACCCAGG - Intronic
966886398 3:184380031-184380053 ACGGGCCGGAGCCGGCGCCCGGG + Intronic
967168696 3:186806766-186806788 AGGGCGGGGCGGCGGCGCGCGGG + Intronic
967859500 3:194140946-194140968 ACGGCGGGGGGCCGGGGCCCCGG - Intergenic
968225522 3:196969820-196969842 TGGACGGAGAGCCGGCGCCCGGG + Intergenic
968284270 3:197499012-197499034 TGGGCCTGGGGCGGGCGCCCGGG + Intergenic
968509142 4:987702-987724 AGCGCCTGGATCCTGCGCCCGGG + Exonic
968549738 4:1216105-1216127 ATGGCGTGGAGCGGGCGCTGGGG - Exonic
968756527 4:2418836-2418858 ATGGCGGGGAGGTGGCGCCCAGG + Intergenic
969114974 4:4865799-4865821 AGGTCCTGGAGCCGGGGCCGGGG - Intergenic
969597799 4:8158777-8158799 CGGGCGCGGAGCCGGCGGGCGGG - Intronic
969715830 4:8867725-8867747 AGGGCACGGAGGCGGCGGCCGGG + Exonic
979327281 4:119394885-119394907 AGCGCGTGGAACTGGTGCCCTGG + Intergenic
984638860 4:182142711-182142733 AGGGCTAGGAGCCCGCGACCAGG - Intergenic
984823544 4:183905442-183905464 GCTGCGTGGACCCGGCGCCCCGG + Exonic
984999827 4:185471773-185471795 TGGGGGTGGGGCCGGCGCCCCGG - Intronic
987193133 5:15499997-15500019 AGCGCGCTGAGCCGGTGCCCAGG + Intergenic
989638190 5:43557428-43557450 GGGGCGTGGACCCTGCGCCAGGG + Intronic
992078903 5:73216150-73216172 AGGGCGCGGCGGCGGCGGCCAGG + Intergenic
997238887 5:132293247-132293269 CGGGCCTGGAGCCTGAGCCCTGG - Intronic
997297066 5:132775096-132775118 AGGGCGTAGAGCCTGAGCGCAGG - Intronic
998583463 5:143403671-143403693 AGCGGGTGGAGGCGGCGCCACGG + Exonic
999203883 5:149834805-149834827 AGGGTGTGGGGCCGGGGCCAGGG - Intronic
1002925633 6:1604540-1604562 AGTGCGCGGTGCGGGCGCCCAGG + Intergenic
1004690214 6:17987246-17987268 CGAGCCTGGAGACGGCGCCCCGG + Intronic
1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG + Exonic
1007785648 6:44277799-44277821 AGGACGTGGGGCCAGCGCCCTGG - Exonic
1008787127 6:55182230-55182252 AGGAAGTGGGGCCGGGGCCCGGG - Intronic
1012340737 6:98119916-98119938 AGGTCATGGAACCGGCGGCCAGG - Intergenic
1015497027 6:133892935-133892957 AGGCCGAGGAGCCTGCGACCCGG + Exonic
1017009334 6:150052756-150052778 AGGTCGTGGAGCTGGAGCCTTGG - Intergenic
1017009741 6:150055218-150055240 GGGTCGTGGAGCCGGAGACCCGG - Intergenic
1018170486 6:161139866-161139888 AGGGCGTGGAGCATGAACCCTGG + Intronic
1018744983 6:166754866-166754888 AGGGCCTGAACCCGCCGCCCTGG - Intronic
1019656113 7:2196961-2196983 AGGGCGAGGACCTGGCGCCTTGG - Intronic
1020462944 7:8443955-8443977 AGGGCGTGCAGACAGCCCCCAGG - Intronic
1020787989 7:12592923-12592945 GGGGCCGGGAGCCGGGGCCCAGG + Intronic
1021085885 7:16421005-16421027 AGGGCGGGGAGCGGGAGGCCGGG + Intronic
1023067201 7:36389775-36389797 GGGGCGGGGAGAGGGCGCCCCGG + Intronic
1024499814 7:50093125-50093147 AGAGCAGGGAGCCGGCGGCCCGG + Exonic
1024580053 7:50793637-50793659 AGGGCGTGGCGCGGGGGCGCGGG + Intergenic
1024614145 7:51093866-51093888 AGGGCCTGGTGCCATCGCCCAGG - Intronic
1026909533 7:74084072-74084094 AGGGCCTGGAGGGGGTGCCCGGG + Intronic
1027233898 7:76286778-76286800 AGGGAGTGGAGACGGGTCCCTGG + Exonic
1033651209 7:143345477-143345499 AGGGCTTGGAGGGGGCGCTCAGG + Intronic
1033658449 7:143388393-143388415 AGGGAGTGGAGCCACAGCCCTGG - Intronic
1034441122 7:151086586-151086608 AGCGCATGGAGCCGGGGGCCGGG - Intronic
1035280539 7:157775694-157775716 AGGGCGTGGAGCTTCCGTCCAGG - Intronic
1036442977 8:8797652-8797674 AGGCGCTGGAGCCGGCGCCCAGG - Intronic
1039469023 8:37802313-37802335 AGGGGGTGGAGGCGCCGGCCTGG - Intronic
1039903083 8:41767021-41767043 GGAGCGTGGAGCCGCCGCCGGGG - Intronic
1042591526 8:70402868-70402890 GGGGCGGGGAGCCGGGGGCCGGG - Intronic
1043954200 8:86342626-86342648 AGGGCGCGGCGCCGGCGACGCGG + Intergenic
1049176398 8:141195294-141195316 AGGGCATGGGGCCTGCCCCCTGG + Exonic
1049218368 8:141417909-141417931 AGCGCCTGGAGCCGGCTCCGCGG + Intronic
1049419576 8:142510837-142510859 GGGGCGCGGAGCCGCCGCTCGGG + Intronic
1049561522 8:143314143-143314165 AGGGGATGGTGCCGCCGCCCTGG + Intronic
1049726295 8:144148031-144148053 TGGGCGGGAAGGCGGCGCCCCGG + Intronic
1049746890 8:144266776-144266798 AGGGCGGGGGGCCGGCGGGCCGG + Exonic
1049779897 8:144424157-144424179 AGGGGATGGAGCCGGCGTCGGGG - Intronic
1050537791 9:6645462-6645484 AGGGCGTGGGGGCTGCGCCTGGG - Exonic
1056532236 9:87497955-87497977 AGGGTCTGGGGCCGGCGCCTGGG + Exonic
1059305348 9:113349590-113349612 AGGGCGCGGAGCCGGGGCCGGGG + Exonic
1059336968 9:113575105-113575127 AGGGCGGGGAGGCGGCTCCCGGG - Intronic
1060801804 9:126549710-126549732 AGGGCCTGAAGCCAGCTCCCTGG - Intergenic
1060893264 9:127201926-127201948 AGGCCGTGGAGCCAGAGCCAAGG + Intronic
1061087782 9:128409329-128409351 AGGGCTGGGGGCCGGAGCCCCGG - Intergenic
1061208456 9:129177419-129177441 GGGGCGCGGAGCAGGCGGCCGGG + Exonic
1062399868 9:136367594-136367616 AGGGAGGGGAGCCGGCGCGTGGG - Intronic
1062406754 9:136400316-136400338 AGCGCGCGGAGGCGGCCCCCAGG - Intergenic
1062574718 9:137200775-137200797 GGGGCGTGGCCGCGGCGCCCAGG - Exonic
1062626802 9:137446997-137447019 AGGGCGGGGGGCCGGTGACCAGG - Intergenic
1185471434 X:386418-386440 TGGGGCTGGAGGCGGCGCCCAGG + Exonic
1186489131 X:9957772-9957794 AGGGCGTGGTTCTGCCGCCCAGG - Intergenic
1189007109 X:37008446-37008468 AGGGCGTGGAGTCCATGCCCGGG - Exonic
1189292795 X:39897685-39897707 GGAGAGTGGAGCCGGAGCCCTGG - Intergenic
1196842591 X:119872029-119872051 AGCCCGTGGAGTCGGCCCCCGGG - Intronic
1200051477 X:153434076-153434098 AGGCCATGGATCCGGGGCCCGGG + Intergenic
1200063817 X:153495506-153495528 AGGGAGTGGAGCATGCGCCTGGG - Intronic
1200154588 X:153968778-153968800 AAGGCCTGGAGCAGGCTCCCTGG - Intronic
1200173798 X:154097789-154097811 AGGGCGGGGCGCGGGCGCGCAGG - Intergenic
1200233557 X:154458023-154458045 CGGGCGGGGAGCCGGGGCGCGGG + Intergenic
1200260216 X:154611329-154611351 AGGAAGTGGAGCCGCCGACCTGG - Intergenic