ID: 1006635126

View in Genome Browser
Species Human (GRCh38)
Location 6:35456453-35456475
Sequence CTGTAGTTCCTGGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006635122_1006635126 -9 Left 1006635122 6:35456439-35456461 CCCAATGGAGTTGACTGTAGTTC 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG 0: 1
1: 0
2: 4
3: 29
4: 312
1006635120_1006635126 21 Left 1006635120 6:35456409-35456431 CCATGGGGAAGGCTGCTTGGGAC 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG 0: 1
1: 0
2: 4
3: 29
4: 312
1006635123_1006635126 -10 Left 1006635123 6:35456440-35456462 CCAATGGAGTTGACTGTAGTTCC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG 0: 1
1: 0
2: 4
3: 29
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006635126 Original CRISPR CTGTAGTTCCTGGAGGAAGA AGG Intronic
900732705 1:4272638-4272660 CTGTAGTTCCTGCATCCAGAGGG + Intergenic
901940060 1:12655238-12655260 CTGTAGTTTTTGGAGGATAAGGG + Intronic
902242821 1:15100178-15100200 CAGGAGTGCCTGGAGAAAGAGGG + Intronic
902256636 1:15193305-15193327 CTGTAGTTCCTGCAGTGGGATGG + Intronic
902979821 1:20114658-20114680 CTGCTCTTCCTGGAGGAAGCTGG + Intronic
905208062 1:36354230-36354252 CTGGGATTCCTGGAGGAAGTGGG + Intronic
906239991 1:44236960-44236982 CTGGAGTCCCTGGAGGAGGTGGG - Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
908671238 1:66549946-66549968 CTGTTGTTCCAGAAGGAAGCAGG + Intronic
909924662 1:81425623-81425645 CTGTAGTGCCTGGTGGAGAATGG - Intronic
909939933 1:81599421-81599443 GTACAGTTCCTGGAGGTAGAAGG + Intronic
912417859 1:109522355-109522377 TTGTCGTGCCTGGAGGGAGAAGG + Intergenic
914255589 1:145959595-145959617 TTGTAGTTGTTGGAGGAACAGGG + Exonic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
915143501 1:153780892-153780914 CTGTAGTTCCTAGGAGAAGCAGG - Intergenic
915565482 1:156710504-156710526 CTGGAGTTTCTGGAGGAAGAAGG + Intergenic
917691355 1:177472761-177472783 CGGAAGTTGCTGGAGGGAGAAGG + Intergenic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
920130358 1:203727422-203727444 CTGAAGTTCCTGAAGGAGGCTGG + Exonic
921236390 1:213136221-213136243 CTCAGGATCCTGGAGGAAGAGGG + Intronic
922439337 1:225639756-225639778 CAGTAATTCTTGGAGGAAGTAGG - Intronic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
1063474081 10:6313365-6313387 CAGTAGTTTATGGAGGGAGATGG + Intergenic
1067106822 10:43372107-43372129 CTGGAGTTCCTGGAATACGAGGG - Intronic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1067951051 10:50738972-50738994 CTGTTGGTCCTGGAAAAAGAGGG + Intergenic
1068223033 10:54067138-54067160 AAGTATTTCCTGGAGGAAAACGG + Intronic
1068687710 10:59886258-59886280 CAGCAGCTTCTGGAGGAAGAAGG + Intronic
1068690522 10:59909053-59909075 ATGTGCTGCCTGGAGGAAGAAGG + Intergenic
1068875037 10:61986740-61986762 CACTAGTTCCTTGAGAAAGAAGG - Intronic
1069261841 10:66408009-66408031 CTGAAGTTCCTGGTGTAAAATGG + Intronic
1069830553 10:71279884-71279906 CTGTGGCTCCTGCAGGAAGTAGG - Exonic
1069949528 10:72009530-72009552 CTGTGGTCCCTGGAGGCAAAAGG + Exonic
1070886408 10:79904184-79904206 CTGTTGGTCCTGGAAAAAGAAGG + Intergenic
1071445282 10:85740614-85740636 TTGTACTTCCTGGAGGTACAAGG - Intronic
1073625842 10:105095929-105095951 ATGTAGTTCCCAGAGTAAGATGG + Intronic
1075115332 10:119621425-119621447 ATGCTGTTCCTGGAAGAAGAAGG + Intergenic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076461457 10:130650092-130650114 GTGTCCTGCCTGGAGGAAGAGGG + Intergenic
1077089924 11:773756-773778 CTGTAGCCCATGGAGGAAAAGGG - Intronic
1078108556 11:8373747-8373769 GTGGAGTTCCTGGAAGAACACGG + Intergenic
1078557949 11:12346020-12346042 TTTTTCTTCCTGGAGGAAGATGG - Intronic
1078603401 11:12753620-12753642 TTGGAGTTCCTGTAGGATGAAGG + Intronic
1078748071 11:14134358-14134380 ATTTAAGTCCTGGAGGAAGAAGG - Intronic
1079345338 11:19646900-19646922 CTGTAGTGCCTGAAGAGAGATGG - Intronic
1079537529 11:21532834-21532856 CTGTGGCTCCTGGAGGGAAAGGG - Intronic
1080851270 11:36072399-36072421 CTCAAGGTCCTGGAGGATGATGG - Intronic
1080935226 11:36856525-36856547 CTGTATTTCCAGGAAGAAGGGGG + Intergenic
1081183430 11:40013010-40013032 CTGTATTTCCTGGAGACACAGGG - Intergenic
1081570135 11:44285785-44285807 AGGGAGGTCCTGGAGGAAGAAGG - Intronic
1081648684 11:44808289-44808311 CTCAAGATGCTGGAGGAAGATGG - Intronic
1084057693 11:66647170-66647192 CTGTAGAAACTGGAGCAAGAAGG - Intronic
1084659145 11:70536946-70536968 GTTTATTTCCTGGAGTAAGAAGG - Intronic
1088086776 11:105990630-105990652 TTGCATTTCCTGGAAGAAGACGG + Intergenic
1089844194 11:121445620-121445642 CTCTGGTTCCGGGAGGAAGCAGG - Intergenic
1090528429 11:127562733-127562755 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1091626100 12:2122082-2122104 CTGGACCTCCTGGAGGCAGAGGG + Intronic
1092401345 12:8181331-8181353 CTGTGGTTCCTGGAGTAGGTAGG + Intronic
1092965715 12:13640045-13640067 CTGCACTTCCTTGAGGAAGAGGG + Intronic
1093194372 12:16112607-16112629 CTCTAGGTCCTGGGTGAAGAAGG + Intergenic
1095975457 12:47938108-47938130 CTGGCCTTCCTGGAGGGAGAAGG + Intronic
1096077507 12:48814665-48814687 CTGCAGTTCCTGGAGAAAGGAGG + Intronic
1096426124 12:51504721-51504743 CTGTAGTTCTGGGAGCAAGGGGG + Intronic
1096497138 12:52045201-52045223 CTGTAGTTCCTGGAGCAGGAGGG + Intronic
1096840724 12:54378155-54378177 CCTTAGTTCCTGGAGGAGGGTGG - Intronic
1096861731 12:54533690-54533712 CTGAAGTTCCAGGAGGAACTCGG - Intronic
1098909682 12:76196201-76196223 CTCTCCTTCCTGGAGGATGAGGG + Intergenic
1100553887 12:95672991-95673013 ATGGAGTTCCTGGGGGATGAAGG + Intronic
1100819486 12:98418065-98418087 CTGAATTTCCTGCAGGAAAAGGG - Intergenic
1101331531 12:103761502-103761524 CTCCAGTCTCTGGAGGAAGAGGG - Intronic
1102813981 12:115847638-115847660 CTGAAGTTCCCAGAGGAAGAGGG + Intergenic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1103665281 12:122559231-122559253 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
1104322792 12:127767678-127767700 CTTCAGTTCCTGGATGAAGATGG - Intergenic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1109318948 13:60785938-60785960 CTTTAATTGGTGGAGGAAGAAGG + Intergenic
1112143188 13:96669360-96669382 ATGTCTTTCCTGGAGGGAGAAGG - Intronic
1112999216 13:105612855-105612877 CTGAGGTTCCCTGAGGAAGAAGG + Intergenic
1113426242 13:110210811-110210833 CTGACCTCCCTGGAGGAAGAGGG + Intronic
1115370126 14:32603623-32603645 ATGTAGTCCCTGCAGGAAAAGGG - Intronic
1115890516 14:38022558-38022580 TTGTAGATCATAGAGGAAGATGG - Intronic
1115971200 14:38946587-38946609 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1117499690 14:56339527-56339549 CCCTAGTTGCTGAAGGAAGATGG - Intergenic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1119425106 14:74529994-74530016 CTGTAGTTCATGGTGGAGCAGGG - Intronic
1120025866 14:79583530-79583552 CTTTTGTTGGTGGAGGAAGAAGG + Intronic
1120373970 14:83676476-83676498 GTGTACTTTTTGGAGGAAGAAGG - Intergenic
1120831411 14:89000739-89000761 CAGCAGTTCCTGTAGGGAGAAGG + Intergenic
1120904546 14:89608992-89609014 CTGTACAACATGGAGGAAGAAGG + Intronic
1120916665 14:89716532-89716554 CTGACCTCCCTGGAGGAAGAGGG + Intergenic
1124140551 15:27073322-27073344 CTGGAGGTCCTGGAGGACCATGG - Intronic
1124792879 15:32746535-32746557 CTTCAGTTCCTGGAGGGAGTTGG - Intergenic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1125416943 15:39463652-39463674 GTGTAGATACTGGAGGAAGATGG - Intergenic
1125757032 15:42071169-42071191 CTGGAGGCCCTGGAGGAAGTTGG + Exonic
1126859596 15:52871041-52871063 CAGAAGTGCCTGGAGAAAGAAGG - Intergenic
1127486365 15:59421393-59421415 CCTTAGTTTCTGGAGGAAAATGG + Intronic
1127564612 15:60174934-60174956 CTGTAGTGAATGGAGAAAGAAGG - Intergenic
1127637798 15:60888206-60888228 CTGGAGTTGATGGAGCAAGAGGG - Intronic
1128553051 15:68610464-68610486 CTGTTGTTCCTGGAACAAGGGGG - Intronic
1128604746 15:69028267-69028289 CTGCAGCTCCTGGAGGGTGATGG - Exonic
1130349489 15:83078674-83078696 CTCTAGATCTTGGAGAAAGAGGG - Intergenic
1131384159 15:91989077-91989099 CTGTAGTTTCTGCAGGAAAAGGG - Intronic
1131819180 15:96254753-96254775 CTGTTGCTACTGGTGGAAGAGGG + Intergenic
1133768595 16:8854784-8854806 CTCCAGCTCCAGGAGGAAGAGGG + Exonic
1135079871 16:19424870-19424892 CTTTCGTTCCTGGAGGATGAGGG + Intronic
1135539350 16:23317957-23317979 CTGTACCTTCTGCAGGAAGAAGG - Intronic
1137235564 16:46614385-46614407 TTCTAGTTCCTGAAGGAATATGG + Intronic
1137712226 16:50574415-50574437 ATTTAGTCCCTGGGGGAAGACGG - Intronic
1138273190 16:55710636-55710658 CTGGAGTTCCAGGAGGACCAAGG + Intergenic
1138517184 16:57542633-57542655 TTGTAGCTTCTGCAGGAAGAAGG - Intronic
1139484447 16:67247992-67248014 CTTTAGTTGTGGGAGGAAGAGGG + Intronic
1140020445 16:71233348-71233370 CTGTAAATCCTAGGGGAAGAAGG - Intergenic
1140345748 16:74211695-74211717 TTGTTCTTCCTGGAGGAAGAGGG + Intergenic
1140425758 16:74859911-74859933 CTGGAGTTCATGGTGGATGAAGG - Intergenic
1140558382 16:75947725-75947747 CTGATCTTCCTGGAGGAACAGGG + Intergenic
1140597039 16:76428688-76428710 CTGTAGGCCCTGGAGGAATCAGG - Intronic
1140712519 16:77691573-77691595 CTGTAGTTCCTGAAGGACCATGG - Intergenic
1141549345 16:84794886-84794908 CTGCGGTGCCGGGAGGAAGAAGG + Intergenic
1142741821 17:1936097-1936119 CCGTGGTTCCTGGAGAAAGCAGG - Exonic
1143179007 17:4972833-4972855 CTGTAGTTCCTCAAGGCAGCGGG + Exonic
1143913109 17:10268263-10268285 CTGAAGTTCCTTGGGGAAAAGGG - Intergenic
1145681307 17:26596508-26596530 TTGTAGGTCCTGGAAAAAGAGGG - Intergenic
1145707309 17:26884142-26884164 TTGTAGGTCCTGGAAAAAGAGGG + Intergenic
1146405745 17:32535867-32535889 CTGTAGTAACTTGAGGGAGAAGG + Intronic
1146623891 17:34421366-34421388 CTGGCGTGTCTGGAGGAAGAGGG - Intergenic
1146692062 17:34883441-34883463 CTCAAGTTCCTAGAGGAGGAAGG - Intergenic
1148067311 17:44881525-44881547 CTGGAGTAACTGGGGGAAGAAGG + Intronic
1148105936 17:45118880-45118902 CTGGAGTTCCTGGAGGACCAGGG - Exonic
1150829666 17:68508079-68508101 CTGAGGTTCCCTGAGGAAGAAGG + Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151787656 17:76283057-76283079 CTGTAGGCCGTGGAGGAAAAGGG - Intronic
1151965582 17:77429586-77429608 GTCTCCTTCCTGGAGGAAGAAGG + Intronic
1152802069 17:82335091-82335113 CTGCAGTTCCTGGGGGCAGGGGG + Intergenic
1153443398 18:5146237-5146259 CTGCATTTCCTGAAGGAAGTGGG - Intronic
1154325784 18:13389515-13389537 GAGTAGTTCTGGGAGGAAGAGGG + Intronic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1160019307 18:75167910-75167932 CTCAAGTTCAAGGAGGAAGAGGG - Intergenic
1160561350 18:79758763-79758785 CTGTAGTTCCAGGAGGCACTTGG + Intergenic
1160850547 19:1189568-1189590 CACTGGTGCCTGGAGGAAGAGGG - Intronic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1163173888 19:15551280-15551302 ATGCAATTCCTGGAGGAAGAGGG - Exonic
1166239359 19:41479274-41479296 CTTTAATTTCAGGAGGAAGAGGG - Intergenic
1166242015 19:41500777-41500799 CTTTAATTTCAGGAGGAAGAGGG - Intergenic
1166373686 19:42315638-42315660 CCCTAGTTCCTGGGGGAGGATGG + Intronic
1168069450 19:53941753-53941775 CCCTGGGTCCTGGAGGAAGAGGG + Intronic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
926858659 2:17284676-17284698 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
927713440 2:25339643-25339665 CGGTAGAACCTGGAGGCAGAGGG + Intronic
929086392 2:38171601-38171623 CTGTAGATCCTAGTGAAAGATGG - Intergenic
932453920 2:71834251-71834273 CTGGAGCTGCTGGAGGAGGATGG + Intergenic
933391459 2:81674131-81674153 CTGTGTTTCCTAGAGGAAAAAGG - Intergenic
937316876 2:120937391-120937413 CTGTGCCTCCTGGAGGTAGAAGG - Intronic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
939538050 2:143457421-143457443 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
940181689 2:150941413-150941435 CTATAGTTCCAGGAAGAAAAAGG - Intergenic
940327260 2:152438420-152438442 ATCAAGTCCCTGGAGGAAGAGGG + Intronic
941869136 2:170365407-170365429 TTGTAGATCCTTGAGGAAAAGGG + Intronic
941978952 2:171434213-171434235 TTGTAGTTCCTGGGAGAAGCCGG + Intronic
942749891 2:179275796-179275818 CTGTCCTTCCTTGAGCAAGAAGG - Intergenic
943165730 2:184322933-184322955 CTGAAGTTCCTTGAAGAAGAAGG + Intergenic
945096406 2:206223486-206223508 GTGGAGTTCCTGGAAGAAGAAGG + Intergenic
946849544 2:223891783-223891805 CTGTATTCCCTGGATGATGAGGG - Intronic
947348332 2:229217142-229217164 CTGTAGATCCTGGACAAAAATGG - Intronic
948048508 2:234961850-234961872 CTGAAGTTCCTGGAGGAGGTGGG + Intronic
948420403 2:237856573-237856595 CTGGAGCCCCTGGAGGAAGATGG - Intergenic
948515981 2:238504253-238504275 CTATAGCTCCAGGAGGAAAATGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169098954 20:2929072-2929094 CTGTAGTCCCCAGAGGCAGAAGG - Intronic
1169571471 20:6911315-6911337 ATGAAGGTCCTGGTGGAAGAAGG + Intergenic
1170784771 20:19457983-19458005 CTGAAATTTCTGGAGGAAAAAGG - Intronic
1173416965 20:42865533-42865555 TTATAGTTCATTGAGGAAGATGG + Intronic
1176132780 20:63503262-63503284 CTCTGGGCCCTGGAGGAAGAGGG + Intergenic
1176299414 21:5091468-5091490 CTCTTGTGCCTGGAGGAGGAAGG - Intergenic
1176850738 21:13910803-13910825 CTGTAATTACAAGAGGAAGATGG + Intergenic
1179522059 21:41952193-41952215 CTGTACTTTTTGGAGGAAAAAGG - Intronic
1179857612 21:44170479-44170501 CTCTTGTGCCTGGAGGAGGAAGG + Intergenic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1181997999 22:26898097-26898119 CTGTAGGGCCAGGAGCAAGATGG + Intergenic
1182440840 22:30362923-30362945 CTGGACTTGCTGGAGGCAGAAGG + Intronic
1182526404 22:30923087-30923109 CTGCAGTTACTGGAGCAGGAAGG + Intergenic
1182731409 22:32498272-32498294 CGATAATTCCTGGAGGAAGGCGG - Exonic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183103672 22:35599503-35599525 CTGAAGTTCCACAAGGAAGAAGG - Intergenic
1183603182 22:38851837-38851859 CTGCAATTCCAGGAGGAAGGGGG + Intergenic
1185314159 22:50171548-50171570 CTGGAGCTCCTGCAGGGAGATGG + Intronic
949269806 3:2201522-2201544 AAGTAGTCACTGGAGGAAGAAGG - Intronic
950471314 3:13188243-13188265 AGGTGGTTCCTGGAGGAAAATGG - Intergenic
950787436 3:15448326-15448348 CTGCTGGTCCTGGAGGAAGTTGG - Intronic
952698407 3:36297919-36297941 GTGTAAGTCCTGGAGGCAGAAGG - Intergenic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
954680802 3:52344962-52344984 CTCTTGCTACTGGAGGAAGAAGG - Intronic
954799940 3:53181246-53181268 CAGTATTTCCTGGAGGACGTGGG + Exonic
955122593 3:56075670-56075692 CTGTAGGTCCTGGAGGTTCAGGG - Intronic
955139088 3:56251150-56251172 CTGTAGTTTCTGGTGGCAGTTGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955963717 3:64366544-64366566 CTGAGGTTCCTTGAGAAAGAAGG - Intronic
956047965 3:65216621-65216643 CTGAAGTCCCTTGAGGAAAAAGG + Intergenic
956087003 3:65622081-65622103 ATGTATTTCCTGCAGGAGGAAGG - Exonic
956845320 3:73177096-73177118 CTGTTCTCCCTTGAGGAAGAGGG + Intergenic
958906855 3:99951272-99951294 CTGTAATTACTGGTAGAAGAAGG - Intronic
959078632 3:101777824-101777846 CTGTATTTCCTCGAGGAAGAAGG + Intergenic
959526028 3:107378342-107378364 CTTTTGTTCATGGAGGAAAATGG + Exonic
960062452 3:113338728-113338750 CTGTAAGTCCTGTAGGGAGAAGG + Intronic
960091693 3:113646474-113646496 CAGTAGTTGCTGGGGGAAGGTGG - Intergenic
961173808 3:124817825-124817847 CTTTAGTTCATGGTGGGAGAAGG - Intronic
962492899 3:135910897-135910919 CCCTGCTTCCTGGAGGAAGAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968468620 4:765850-765872 CAGAAGTTGCTGGGGGAAGACGG - Intronic
969191656 4:5526202-5526224 CTGCAGTTCCTGTATGTAGAGGG - Exonic
969433049 4:7167190-7167212 CTGCAGGTCCTGAAGGGAGAAGG + Intergenic
969703558 4:8780497-8780519 CCACAGTTCCTGGAGGAAGGAGG - Intergenic
969778763 4:9380239-9380261 CTGTGGTTCCTGGAGTAGGTAGG - Intergenic
970140543 4:12977396-12977418 CTGCTGTTTCTGGAGGAAGTGGG - Intergenic
971211857 4:24625460-24625482 CTGTAGTTCCTGGATGTTGGTGG - Intergenic
972880378 4:43415802-43415824 CTCTATTTCCTGTAAGAAGATGG + Intergenic
973125389 4:46577223-46577245 GTGTAGTTCCAGGAGAAAGTTGG + Intergenic
974118678 4:57611810-57611832 CTGTAGTCCCAGGGGGATGAGGG + Intergenic
977612809 4:99053700-99053722 CTGTAGCTCATGGATCAAGAAGG - Intronic
982688951 4:158526939-158526961 CTTGAGTTCCTGGAGCAACATGG - Intronic
983416439 4:167461312-167461334 CTGCAGTGCCTGTAGGAATAAGG - Intergenic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
985041659 4:185897123-185897145 GTGACGGTCCTGGAGGAAGAGGG - Intronic
985332504 4:188854629-188854651 CTGTAGTTACTGGAGACAGCTGG - Intergenic
985528478 5:420129-420151 GTGCAGTTCCTGGAGGAGAAGGG + Intronic
985780018 5:1865646-1865668 CTGAATTTCCAGGAGGCAGACGG - Intergenic
985941374 5:3139016-3139038 ATGAAGTCCGTGGAGGAAGAGGG - Intergenic
986412901 5:7499322-7499344 GGGTAGTTGCTGGAGGGAGAGGG + Intronic
986416404 5:7532470-7532492 CTTTTCTTCCTGGAGGAACAAGG - Intronic
989046712 5:37281005-37281027 CTGTAATTTCTTGAGGAAAAAGG + Intergenic
990754369 5:59052174-59052196 CTGTAGTTCGAGCAGGGAGAGGG + Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
991954187 5:71975979-71976001 CTGTAGTTGTGGGAGTAAGAGGG + Intergenic
992889295 5:81189161-81189183 CTGTACTTCCTGCAGGCAGGTGG - Intronic
992937105 5:81719307-81719329 CTTTAGCTCTTGGAGGAAGCGGG - Intronic
996211614 5:120817970-120817992 CTGTAGTTCCTGGACCAGGGAGG - Intergenic
997360073 5:133289377-133289399 CTGGGCTTCCTGGAAGAAGATGG - Intronic
1000390662 5:160719443-160719465 CAGTAGTTCCTGGAGGGCAAAGG + Intronic
1000470046 5:161629840-161629862 CTAAAGTCCCTGGAGGGAGATGG + Intronic
1000576003 5:162975925-162975947 CTCTAGTTCCTGGGTGAGGATGG - Intergenic
1001275325 5:170346576-170346598 ATGCAGTTCCTGGAGACAGAGGG + Intergenic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1002836378 6:868619-868641 ATTTAGGTCCTGGAGGTAGAGGG - Intergenic
1003618587 6:7677225-7677247 CTGAGGTTCCCCGAGGAAGAAGG + Intergenic
1004245166 6:13967815-13967837 CTGTAATTCCAGGAGGCTGAGGG - Intronic
1004395910 6:15246199-15246221 ATGTAGTTTTTGGAGGAAAAAGG + Intergenic
1005114429 6:22319703-22319725 CAGTAGTTCCTGGTGGATGAAGG + Intergenic
1005473834 6:26188181-26188203 CTGTAGCTGCTGGAGAAACAAGG - Intergenic
1005559674 6:27025765-27025787 CTGGAGTTTCCTGAGGAAGAGGG - Intergenic
1006067435 6:31472019-31472041 ATGGAGGGCCTGGAGGAAGAGGG + Intergenic
1006208682 6:32374373-32374395 CTTTAAATCCTGTAGGAAGAAGG - Intergenic
1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG + Intronic
1008556075 6:52673707-52673729 CTATAGTTCCTGGAGGACCAAGG + Intronic
1010170278 6:72966907-72966929 CTGTTGTTTCTGGAGGGAGTTGG + Intronic
1011645428 6:89453128-89453150 CTGTAGTTACTTTTGGAAGAAGG - Intronic
1012303351 6:97618322-97618344 CTGTAGTTCCAGGATGAGAAAGG + Intergenic
1012764744 6:103352637-103352659 CTGTCATTCCTGGTGGAAGGTGG + Intergenic
1012972626 6:105748068-105748090 CTGCAGTCCCCTGAGGAAGAAGG + Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014486532 6:122005921-122005943 CTGGAGTCCCTGGAGAAAGTTGG + Intergenic
1014619993 6:123655723-123655745 CTCTAGTGCCCTGAGGAAGATGG + Intergenic
1016531733 6:145065828-145065850 GTGTACTTACTGGAAGAAGATGG - Intergenic
1017297792 6:152818674-152818696 CTGTTGTGCCAGGAAGAAGATGG - Intergenic
1017598439 6:156055441-156055463 TTTTAGTTCCTGAAGCAAGATGG - Intergenic
1018774635 6:167001535-167001557 CTGGAGTTACTGGATGAATAAGG - Intronic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019309159 7:351901-351923 CGCTCGTCCCTGGAGGAAGAGGG - Intergenic
1021812567 7:24417381-24417403 CTGCAGTGACTGGAGGAAAAGGG - Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022606835 7:31823740-31823762 CTTAAGTTGCTGGAAGAAGATGG + Intronic
1022788634 7:33664297-33664319 CAGAAGGTCCTGGAGGAAAAGGG + Intergenic
1022982127 7:35613896-35613918 GTGTAGTTCTTTGAGGCAGATGG + Intergenic
1023962023 7:44935209-44935231 CAGTAGGTCCTGGAGGGAGGTGG - Intergenic
1027125408 7:75553520-75553542 CTGGCCTCCCTGGAGGAAGAGGG - Exonic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1027814905 7:82955964-82955986 TTGTAGTTACTGGAGGAGGAGGG - Exonic
1027945842 7:84745025-84745047 CTGTAGTTCCATGGGGAAAATGG - Intergenic
1028579984 7:92398637-92398659 CTGTAGTTGCTGGAGGAATCAGG - Exonic
1028601818 7:92609017-92609039 CTCTAGTTCCTGGGAGCAGAGGG + Exonic
1029205778 7:98868841-98868863 CTGTATTTCCAGGAGGAAATAGG + Intronic
1030611410 7:111693486-111693508 CTGGAGTTCCCTGAGGCAGATGG + Intergenic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032239534 7:130149978-130150000 TGGGAGTTCCTGGAGGAACAGGG - Intergenic
1032761355 7:134946495-134946517 CTGTAGTTACCAGAGGCAGAGGG - Intronic
1033116136 7:138627142-138627164 CTGTGATAGCTGGAGGAAGATGG + Intronic
1033141668 7:138832533-138832555 CTGAAAAACCTGGAGGAAGAAGG + Intronic
1034820974 7:154216033-154216055 CTGTGGTTCCTGGCAGAGGAAGG - Intronic
1034888870 7:154821883-154821905 GTGAATTTCCTGGAGGATGACGG - Intronic
1035323435 7:158049523-158049545 CTGAAGTTCCTTGAGGAACTCGG + Intronic
1036276214 8:7354212-7354234 CTGTGGTTCCTGGAGTAGGTAGG - Intergenic
1036345133 8:7956135-7956157 CTGTGGTTCCTGGAGTAGGTAGG + Intergenic
1036840466 8:12116902-12116924 CTGTGGTTCCTGGAGTAGGTAGG + Intergenic
1036862264 8:12363147-12363169 CTGTGGTTCCTGGAGTAGGTAGG + Intergenic
1039665918 8:39527959-39527981 CTGAAGTTCCTGTTGGAGGAAGG - Intergenic
1040291289 8:46126553-46126575 CTGTTGTATCTGGAAGAAGAGGG + Intergenic
1040552639 8:48450443-48450465 CTGTAGCTCCTGCAGGGAGAGGG + Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041291305 8:56310857-56310879 CAGTAGTTCTTGTAGGAACATGG + Intronic
1041380628 8:57250985-57251007 CTCCAGTTCCTGGAGGCAGCTGG - Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042360103 8:67872660-67872682 CTCTAGTTTCTTGAGGTAGAAGG - Intergenic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1044241311 8:89892233-89892255 TTGGTGTTCCTGCAGGAAGAAGG - Intergenic
1044882335 8:96736331-96736353 ATATAGTTCCTGGCTGAAGATGG + Intronic
1045828372 8:106428290-106428312 CTGTATTTTCTACAGGAAGAAGG + Intronic
1047301343 8:123616121-123616143 CTGTAGCTCAGGTAGGAAGATGG - Intergenic
1047389275 8:124437048-124437070 CTATAGGTCCTGGCTGAAGAGGG + Intergenic
1047389294 8:124437142-124437164 CTATAGGTCCTGGCTGAAGAGGG + Intergenic
1049454117 8:142678365-142678387 CTGTTGTTCCTGCCGGAAGCTGG - Intronic
1052333877 9:27300022-27300044 AAGTTGTTCCAGGAGGAAGATGG + Intergenic
1052769122 9:32671420-32671442 CTGTAATCCCTGGAAGAAAATGG - Intergenic
1055904531 9:81277352-81277374 CTGTAGTTGATGGAGGTAGGAGG - Intergenic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1059568479 9:115408477-115408499 CTGATGTCCCTGGAGGCAGAGGG - Intergenic
1059938563 9:119335839-119335861 CTGTACCTCCTGAAGGTAGAAGG - Intronic
1060963685 9:127699498-127699520 CGGGGGTTCCTGGAGTAAGACGG + Intronic
1061910215 9:133718443-133718465 CTTTAATTTCTGGAGAAAGAGGG - Intronic
1061975401 9:134065848-134065870 CTCCAGAGCCTGGAGGAAGAGGG + Intronic
1062329985 9:136035622-136035644 CTGTAGTTACATGAGGATGATGG + Intronic
1062509193 9:136895518-136895540 CTGTCCTTCCTGGAGAAAAAAGG + Intronic
1062539328 9:137034658-137034680 CGGCAGTTCCTGCAGGAAGGAGG + Exonic
1203376994 Un_KI270442v1:384372-384394 CTGTTGGTTCTGGAGGCAGAAGG + Intergenic
1185475664 X:413906-413928 CCGTGGGTCCTGGAGGAAGGAGG - Intergenic
1186271803 X:7896682-7896704 CTGAAGTTACTCCAGGAAGAAGG - Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1187496887 X:19803006-19803028 CTGAAGTCGCTGGAGGAAGGTGG - Intronic
1189223284 X:39391242-39391264 CTGAGGTTCCCAGAGGAAGAAGG - Intergenic
1190718176 X:53121975-53121997 CTATAGCTCCTGGAAGGAGAGGG + Intergenic
1192233815 X:69283914-69283936 ATTTAGTGCCTGGAGAAAGAGGG - Intergenic
1196934927 X:120720038-120720060 CTGTAATTACTGTAGGAAGTGGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1198180748 X:134206178-134206200 CTTTGGTTGCTGGAGGGAGAAGG + Intergenic
1198332323 X:135633159-135633181 CTGTAGCTGCTGGAGGAACTGGG - Intergenic
1198532998 X:137563662-137563684 CTGTAGTCCCTGGAACAAAAAGG - Intergenic
1198543168 X:137662042-137662064 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
1198999684 X:142620120-142620142 TTGTCGTGCCTGGAGGAATAGGG + Intergenic
1200031258 X:153297648-153297670 CTGTAGGTCTTGCAGGAAGCAGG - Intergenic
1200879953 Y:8202375-8202397 CTGCTGTTCCTGGAGGCAGCAGG + Intergenic
1201054526 Y:9975546-9975568 CTGCTGTTCCTGGAGGCAGCGGG - Intergenic
1201908225 Y:19106541-19106563 CTGTATTTGCTTGAGGAAGGTGG + Intergenic