ID: 1006635463

View in Genome Browser
Species Human (GRCh38)
Location 6:35458350-35458372
Sequence GCAGCCAGGTGCAGAGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006635463 Original CRISPR GCAGCCAGGTGCAGAGCCGC AGG (reversed) Exonic
900018074 1:168482-168504 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
900048332 1:527078-527100 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
900070557 1:768930-768952 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
900082615 1:869899-869921 GCAGCCGGCTCCGGAGCCGCGGG - Intergenic
900093191 1:929462-929484 GCAGCCTGGTGCAAGGCCACTGG - Intronic
900098141 1:948689-948711 GCAGCCAGGTGCAGGGCCAAAGG - Intronic
900116038 1:1028331-1028353 CCAGCCAGGTGCAGGGCGGGGGG - Intronic
900192399 1:1356980-1357002 GCAGCCAGGTGGAGTGGCCCCGG - Intronic
900229062 1:1547079-1547101 GCAGCCACATGCAGAGGGGCAGG + Intronic
900722510 1:4186554-4186576 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
900895824 1:5482246-5482268 CCAGGCAGGTGCAGAGCAGAGGG + Intergenic
901173322 1:7279966-7279988 CCAGCCAGGTCCAGAGCGGGAGG + Intronic
901884133 1:12210893-12210915 CCAGCCAGGTGCAGACGTGCAGG - Intergenic
902546549 1:17194013-17194035 GCAGCCAGCTGCAGAGCCTGGGG - Intergenic
902644421 1:17788590-17788612 TCAGCCAGGTGCAGAGGAGGAGG + Intronic
902649829 1:17829848-17829870 GCAGCCAGGTGCAGAGGGGAGGG + Intergenic
902771692 1:18648872-18648894 GCAGAGAGGTGCAGAGGGGCTGG + Intronic
903183187 1:21615271-21615293 GCAGCCAGGTGCTCAGGCACTGG - Intronic
904328818 1:29744934-29744956 GCAGCCAGGAGCACAGGGGCGGG - Intergenic
904370645 1:30045571-30045593 GCAGCCAGGAGCACAGGGGCGGG - Intergenic
904613449 1:31737545-31737567 GCAGGCAGGGACAGAGGCGCTGG + Intronic
905033459 1:34902685-34902707 GCAGGCAGGTGGAGAGAGGCAGG + Intronic
905775413 1:40664836-40664858 GCAGCATGGTGCAGAGCCCAGGG - Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
906105854 1:43291852-43291874 GCAGCCAGGCGCAGTGACTCAGG - Intergenic
906376077 1:45297737-45297759 GCAGACAGGTACAGATCAGCAGG - Intronic
907308221 1:53525349-53525371 GCAGGTAGGTGCAGAGGCACCGG + Intronic
908825271 1:68126907-68126929 GGAGCCAGGTGCAGTGGCTCAGG + Intronic
909035503 1:70590693-70590715 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
912048579 1:105492955-105492977 GGAGCCAAGTGCAGAGACTCAGG + Intergenic
913975128 1:143449868-143449890 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
913984203 1:143550591-143550613 GGAGCCAGGAGCAGGGCCACTGG + Intergenic
914069520 1:144275484-144275506 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
914109635 1:144690870-144690892 TCGCCCAGGTGCAGATCCGCAGG + Intergenic
915117262 1:153608722-153608744 GCAGCCAGGTTCTGAGACCCGGG - Intronic
915519855 1:156435796-156435818 GACGCCAGCCGCAGAGCCGCGGG + Intergenic
916470654 1:165119185-165119207 GCAGTCAGCTGCAGGGCCGTTGG - Intergenic
917869575 1:179229529-179229551 GAGGCCGGGTGCGGAGCCGCCGG - Exonic
922105917 1:222514346-222514368 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
922266256 1:223986957-223986979 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
922351159 1:224735536-224735558 GCAGCCAGGTGAAGAGGAGGAGG + Intronic
922811126 1:228416313-228416335 GCAGCCAGAGCCAGAGCCCCAGG - Intronic
922934855 1:229414773-229414795 GCAGCCAGTTCCAGAGCCCCTGG + Intergenic
923437675 1:233983033-233983055 GCAGCCACGTGGAGAGCTACAGG - Intronic
923962818 1:239103759-239103781 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
924348102 1:243091913-243091935 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
924598102 1:245464872-245464894 GCAGCTATGTGCAGAGCCAGAGG + Intronic
1062799429 10:368455-368477 GCAGGCAGAGGCAGAGCTGCGGG + Intronic
1062966804 10:1613804-1613826 GCTCTCAGGTGCAGAGCTGCGGG - Intronic
1064000646 10:11661351-11661373 GCAGCCAGGGACAGAGTGGCAGG + Intergenic
1066728257 10:38412988-38413010 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
1067533790 10:47093283-47093305 GCAGCCAGGTGTGGAGTGGCTGG + Intergenic
1067692189 10:48509021-48509043 GCATTCAGTTTCAGAGCCGCGGG - Intronic
1069710007 10:70482104-70482126 GCAGCCAGGTGCATGGCCCTGGG + Intronic
1070482805 10:76901804-76901826 GCATCCAGGAGCAGAGCTGTGGG + Intronic
1070771059 10:79082588-79082610 GAATCCAGCTGCAGAGCTGCAGG + Intronic
1070775918 10:79109708-79109730 GCAGCCAGGTGCACAAACCCAGG + Intronic
1071889480 10:89987454-89987476 GCAGCCAGGTTCAGACCTCCAGG - Intergenic
1072011244 10:91304810-91304832 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1072213810 10:93271414-93271436 GGAGGCAGGTGCAGAGCCTCTGG - Intergenic
1072799006 10:98379239-98379261 ATAGCCAGCTGCAGAGCTGCTGG + Intergenic
1073301545 10:102473975-102473997 GCAGCCAGGTGCCCAGCAGCGGG - Exonic
1075238742 10:120758072-120758094 GCACCCAGGGGCAGAACAGCAGG - Intergenic
1076163481 10:128263728-128263750 GCAGCCAGGTCCAGTGCTGCTGG - Intergenic
1076167995 10:128297643-128297665 GTATCCATGTGCAGAGCCACAGG - Intergenic
1076423667 10:130351982-130352004 GCAGCCTGGAGCAGAGGCCCCGG + Intergenic
1076930226 10:133527463-133527485 GGAGGCAGGTGCACAGCAGCTGG + Exonic
1076974676 11:163678-163700 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
1077259495 11:1608266-1608288 GCAGACAGGTACACAGCAGCCGG + Exonic
1077919102 11:6630088-6630110 GCTACCACGTGCAGGGCCGCGGG + Exonic
1081678836 11:44987754-44987776 GCAGCCAGGGGCAGGGGCTCAGG - Intergenic
1081758456 11:45560776-45560798 TCAGCCAGGTGGAGAGCTGGGGG - Intergenic
1081855864 11:46303361-46303383 GCAGCCAAGTGCAGTGGCTCAGG + Intronic
1084613249 11:70217630-70217652 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1084949525 11:72657111-72657133 GCAGCCACTTGCACAGCCCCTGG + Intronic
1085619010 11:78023264-78023286 GCAGCCAGGGGCACTTCCGCTGG - Exonic
1085752478 11:79173707-79173729 AAAGCCTGGTGCAGAGCTGCTGG + Intronic
1089178151 11:116563065-116563087 GCTGACATGTGCAGAGACGCTGG - Intergenic
1089253448 11:117181189-117181211 GCAGACATGTGCAGGGCAGCAGG - Intronic
1089525551 11:119094603-119094625 GCGGGCAGGTGCGGCGCCGCCGG + Exonic
1090024582 11:123156811-123156833 GCAGCCATGTGCACTGCTGCTGG - Intronic
1091725664 12:2845019-2845041 GCAGCTATGTGAAGAGCCACGGG + Intronic
1092229913 12:6770511-6770533 GGAGCCAGGTGAAGAGTGGCTGG - Exonic
1092283305 12:7113761-7113783 GGAGCGAGGTGAAGAGCAGCAGG + Intergenic
1093812805 12:23509335-23509357 GCAGCCACTTTCAGAGCCCCTGG - Intergenic
1093951100 12:25165536-25165558 GCAGCCACTTTCAGAGCCCCTGG + Intronic
1094612566 12:32008444-32008466 GCAGCCAGGTGCAGTGGCTCAGG + Intergenic
1094825784 12:34268026-34268048 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1095584639 12:43836356-43836378 GAAGGCAGGAGCAGAGGCGCCGG - Intronic
1096784528 12:54009409-54009431 GAAGCCGGGCGCCGAGCCGCCGG - Exonic
1097011082 12:55953830-55953852 GCAGCAATGTACAGAGCCTCGGG - Exonic
1098276026 12:68812025-68812047 GAAGCCAGGTGCAGTGGCTCAGG - Intronic
1099836069 12:87910714-87910736 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1102187013 12:110956976-110956998 GCAGCCAGGCAGAGAGGCGCGGG + Intergenic
1102599954 12:114022151-114022173 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1103408561 12:120693949-120693971 GGAGCCAGGTGCAGAGTGGGTGG + Intronic
1103726040 12:122997815-122997837 GCAGACAGGAGCAGGGCTGCAGG - Intronic
1103730984 12:123027668-123027690 GCAGTCAGTGGCAGAGCCACTGG + Intronic
1103821786 12:123704545-123704567 TGATCCAGGTGCAGACCCGCTGG + Exonic
1104769499 12:131352262-131352284 GCAGCCTGCTGCGGAGCTGCAGG - Intergenic
1105819474 13:24066835-24066857 GCAGCCAGATTCAGAGACTCCGG + Intronic
1106628369 13:31443660-31443682 GGAGACAGGGGCAGAGCCTCTGG - Intergenic
1107002501 13:35566079-35566101 ACAGCCAGGTGCAGTGGCTCAGG + Intronic
1107717691 13:43216879-43216901 ACAGCCAGCTGCAGGGCTGCTGG - Intronic
1108354778 13:49620401-49620423 GCAGCCAAGTGCAGAGGCGTTGG + Intergenic
1108458046 13:50636303-50636325 GCCTCCAGGTGCTGAGCCTCTGG + Intronic
1108603161 13:52011945-52011967 GCAGCCAGGCGCAGAGTCCGAGG - Intergenic
1108919514 13:55658297-55658319 GCAGCCACTCGCAGAGCCCCTGG - Intergenic
1110845376 13:80186061-80186083 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1111237766 13:85431247-85431269 GCAGCCAGGTGCTGCTCTGCAGG + Intergenic
1111940923 13:94606008-94606030 ACAGCCAGGTGCAGTGGCTCAGG + Intronic
1113385603 13:109845026-109845048 GAAGCCCGGTGCAGAGGCCCAGG + Intergenic
1113725885 13:112601476-112601498 GCAGCCCTGGCCAGAGCCGCGGG - Intergenic
1113768885 13:112896146-112896168 ACAGCCAGGTGCAGAGGGGAAGG + Intronic
1113783741 13:112991050-112991072 GGACCCAGGTACAGAGCCCCAGG - Intronic
1114031416 14:18583842-18583864 GCAGCCGGCTCCGGAGCCGCGGG - Intergenic
1116703258 14:48265697-48265719 GCAGCCAGTCCCAGAGCCCCTGG - Intergenic
1122817246 14:104319788-104319810 GAAGCCAGAGGCAGAGCCGGAGG - Intergenic
1122873183 14:104650743-104650765 CCACCCTGGGGCAGAGCCGCTGG + Intergenic
1122906016 14:104801842-104801864 GCAGCCAGGGGCCCAGCCACTGG + Exonic
1123931502 15:25173814-25173836 TCAGCCAGGTGCCCAGCCCCTGG + Intergenic
1123935737 15:25193189-25193211 TCAGCTAGGTGCTGAGCCCCTGG + Intergenic
1123936694 15:25197438-25197460 TCAGCCAGGTGCTTAGCCCCTGG + Intergenic
1123939877 15:25211663-25211685 TCAGCCAGGTGCTCAGCCCCTGG + Intergenic
1123940730 15:25215411-25215433 TCAGCCAGGTGCCCAGCCCCTGG + Intergenic
1123943704 15:25228836-25228858 TCAGCCAGGTGCTCAGCCTCTGG + Intergenic
1123946559 15:25241615-25241637 TCAGCCAGGTGCTCAGCCCCTGG + Intergenic
1123949220 15:25253774-25253796 TCAGCCAGGTGCACAGCCCTTGG + Intergenic
1125973439 15:43930708-43930730 GATGCCAGGTGCAGTGCTGCAGG + Intronic
1127489649 15:59450209-59450231 GCAGCGAGGTGCAGTGGCTCAGG - Intronic
1128404364 15:67320171-67320193 GCAGGCAGCTGCAGAACTGCTGG - Intronic
1128550830 15:68596916-68596938 GCAGGCAGGAGGAGAGCCACAGG - Intronic
1128913705 15:71540415-71540437 GCGGCCAGGTGCAGTGGCTCAGG - Intronic
1130781098 15:87042040-87042062 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1131055403 15:89371752-89371774 GCCGCGCGGTGCAGAACCGCCGG + Intergenic
1131184080 15:90260569-90260591 GCGGCCAGGTGCAGTGACTCAGG + Intronic
1131417542 15:92273646-92273668 GCAAACATGTGCAGAGCCGGTGG - Intergenic
1131554164 15:93382447-93382469 GCAGCCAGCTGCCGAGCACCTGG + Intergenic
1132498576 16:275064-275086 GCGCCCAGGTGCAGGGCCTCTGG + Exonic
1132601464 16:774894-774916 TCAGCCGGGGGCAGCGCCGCAGG + Exonic
1132985876 16:2767363-2767385 TCAGCCAGGTTCACAGCCGAAGG - Exonic
1133055749 16:3144684-3144706 GGACCCAGGGGCAGAGCCTCGGG + Intronic
1133063737 16:3191757-3191779 CCAGCCAGGGGCAGAGGGGCGGG + Intergenic
1133679857 16:8110747-8110769 GCAGCCAGGAGCAGTGGCTCAGG + Intergenic
1135274663 16:21101897-21101919 CCTTCCAGGTGCAGAGCCGGAGG + Intronic
1135493433 16:22930689-22930711 GCAGCCAGGTGCTGTGGCTCAGG + Intergenic
1137072065 16:35912299-35912321 GCAGCCAGGAGCGGAGCCCAAGG + Intergenic
1138399849 16:56736605-56736627 GAAGCCAGGGGCAGAGGCGGAGG + Intronic
1139303336 16:65963277-65963299 TCAGCCAGGTGCAGAGTCTGCGG - Intergenic
1139808235 16:69588229-69588251 GCGGCCAGGTGCAGAGGCTCAGG - Intronic
1139938292 16:70586994-70587016 GCAGGCAGGAGCAGGGCCCCAGG - Intronic
1140416719 16:74778882-74778904 GCAGCCAAGCGCACAGTCGCAGG + Intergenic
1140497208 16:75399698-75399720 GCAGCCAGGTGCAGTAGCTCGGG + Intronic
1140819975 16:78654179-78654201 CCACCCAGGTGAAGAGCCGAAGG - Intronic
1141865173 16:86745344-86745366 GCAGCCACTCGCAGAGCCCCTGG - Intergenic
1142129491 16:88426211-88426233 ACAGCCAGCAGCAGAGCAGCTGG - Intergenic
1142167455 16:88600011-88600033 GCAGCCATGTGCAGGGCCCCAGG + Intronic
1142309475 16:89303971-89303993 GAAGCCAGGGACAGAGCCGAGGG + Intronic
1142445590 16:90133980-90134002 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
1142461924 17:101491-101513 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
1142518021 17:445914-445936 GGAGCCAGGGGGAGAGACGCTGG + Exonic
1143180645 17:4982094-4982116 GCAGCCAGTAGCAGCGCCGATGG + Exonic
1144850413 17:18241306-18241328 GCAGCCAGGTGTACAGGCACGGG + Intronic
1147569051 17:41556385-41556407 GCAGGGAGGTGAAGAGCCCCTGG - Intergenic
1148554536 17:48570457-48570479 GCAGCCAGGACCACAGCCTCCGG + Intronic
1148863940 17:50618943-50618965 GCCGCTGGGTGCAGAGCCCCAGG - Exonic
1151416318 17:73968185-73968207 GAAGACAGGTGCAGTGCCTCAGG + Intergenic
1151526282 17:74671194-74671216 GCAGCCGGGTGCTGAGCCTCCGG + Intronic
1152093523 17:78259318-78259340 CCAGCCAGGTGCAGAGCAGGGGG + Intergenic
1152096991 17:78278280-78278302 GGAGACAGGCGCAGAGCCTCTGG + Intergenic
1152521844 17:80860985-80861007 ACAGCCAGGTGCAGAGCACTGGG - Intronic
1152599584 17:81255274-81255296 GCAGACAGCTGCAGAGCGCCGGG - Intronic
1153098379 18:1435781-1435803 ACAGCCAGGTGCAAAGGTGCTGG - Intergenic
1154979703 18:21492614-21492636 GCAGCCAGGTGAAGAACCTCAGG - Intronic
1155962029 18:32002997-32003019 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1156237390 18:35218159-35218181 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1156370510 18:36468161-36468183 GCAGCCAGGTGCATCCCCACAGG + Intronic
1156924023 18:42555810-42555832 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1157213065 18:45760277-45760299 GCAGTGAGGGGCAGAGCGGCAGG - Intergenic
1157776736 18:50402055-50402077 TAAGCCAGGTGCAGATACGCTGG - Intergenic
1157867452 18:51198136-51198158 GCGGCCTGGAGCAGAGCTGCAGG + Intronic
1158454910 18:57597558-57597580 ACAGCCAGGTGCAGTGGCTCAGG + Intergenic
1158895468 18:61908935-61908957 GCAGCCAGGTGGAGAACCTGTGG + Intergenic
1158914399 18:62107311-62107333 TCAGCCAGGTGCAGTGGCTCAGG + Intronic
1159292405 18:66439805-66439827 GCAGCTCGGTGCAGGTCCGCAGG + Intergenic
1160651628 19:233859-233881 GCAGCCGGGTGCAGTGGTGCAGG + Intergenic
1161085778 19:2334238-2334260 ACAGCCACGGGCAGAGCCACGGG - Intronic
1162041346 19:7972771-7972793 GCAGCCAGGTGCGGTGGCGCGGG - Intronic
1162957484 19:14107320-14107342 GCTGCCGGGTGCAGAGCCCAGGG - Intronic
1162999111 19:14355045-14355067 TCAGCCAGGTGCAGTGGCTCAGG - Intergenic
1163642375 19:18469042-18469064 GGGGCCAGGTGCAGAGCCCAGGG + Intronic
1165755977 19:38293198-38293220 GTGGCCAGGTGCAGTGCCACAGG + Intronic
1166533761 19:43558853-43558875 TCAGCCAGGTGCAGTGGCTCAGG + Intronic
1166655568 19:44609035-44609057 GTAGCCAAGTGCAGAGGCTCAGG + Intergenic
1167765317 19:51478742-51478764 GCAGCTAGGAGCAAAGCGGCGGG + Intronic
1168297493 19:55384460-55384482 GTAGCCAGGCGCACAGCCACGGG + Exonic
1168510670 19:56971182-56971204 GCACTCAGGGGCAGAACCGCTGG - Intergenic
1168669234 19:58228719-58228741 GCTGCAAGGAGCAGAGCCGCGGG + Intronic
925909640 2:8565456-8565478 GCAGCCAAGTGCAGATGGGCAGG + Intergenic
927176153 2:20410378-20410400 ACAGGCAGGTGCAGAGGCACTGG + Intergenic
927504874 2:23606326-23606348 GCACCCAGCAGCAGAGCGGCTGG - Intronic
927869352 2:26613855-26613877 TCACCCAGGTGCAGAGAGGCAGG - Intronic
928337868 2:30413578-30413600 GCATACAGGAGCAGAGCCACAGG + Intergenic
928371859 2:30745677-30745699 GCAGACAGCAGCAGAGGCGCAGG + Intronic
928436442 2:31257469-31257491 GCGGCCAGGTGCAGAACGGCTGG + Intronic
928827627 2:35440417-35440439 GCAGCCACTCCCAGAGCCGCTGG - Intergenic
931608896 2:64078490-64078512 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
931894500 2:66713984-66714006 GCAGGCAGGTCCAAAGCAGCAGG + Intergenic
932295884 2:70623018-70623040 GCAGCCACTTCCAGAGCCCCTGG + Intronic
934290121 2:91685102-91685124 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
934620068 2:95798348-95798370 GCACCCAGGAGCAGATCCGGTGG - Intergenic
934715793 2:96542542-96542564 GCAGCCAGGTTGTGAGCCACAGG - Intronic
935053084 2:99540519-99540541 GCAGCCAGGGGCAGTGGCTCAGG - Intergenic
935301688 2:101698226-101698248 GCCGCCGTGGGCAGAGCCGCGGG + Intronic
935331000 2:101978253-101978275 GCAGCCAGGTTAAGAACCCCTGG + Intergenic
935701969 2:105820561-105820583 GAAGGCAGGGTCAGAGCCGCAGG - Intronic
935738931 2:106129407-106129429 GCACCCTGGTGCAGATCCCCTGG - Intronic
935925949 2:108068665-108068687 ACGGCCAGGAGCAGAGCCTCTGG + Intergenic
938496784 2:131801954-131801976 GCAGCCGGCTCCGGAGCCGCGGG + Intergenic
939003466 2:136761125-136761147 GCAGGCAGGGGCAGAGGGGCAGG - Intergenic
940107378 2:150115001-150115023 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
941233293 2:162938598-162938620 ACAGGCAGGTGCAGAGGCCCGGG - Intergenic
941340431 2:164298246-164298268 GCAGCCACTCGCAGAGCCCCTGG + Intergenic
942097113 2:172544129-172544151 GCAGCCACTCGCAGAGCCCCTGG + Intergenic
943865370 2:192920450-192920472 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
944425677 2:199580190-199580212 GCAGCGGGGTTCAGAGCCACGGG - Intergenic
945258350 2:207821148-207821170 ACAGCCAGGTGCGGAGCCCAAGG - Intergenic
946097938 2:217291673-217291695 GCAGGCAGGTGCAGAGGCTGGGG + Intronic
947434049 2:230057485-230057507 GCAGCCAGATGCAGTGGCTCAGG + Intronic
947768387 2:232651958-232651980 CCAGCCTGGGGCAGAGCTGCGGG + Intronic
947943237 2:234076712-234076734 GCAGCCAGGTGTTGGGCCCCAGG - Intronic
948420949 2:237859699-237859721 GCAGCCAGAGGCCGCGCCGCGGG - Exonic
948582290 2:238996572-238996594 GCAGCCGGGAGCAGAGCCCAGGG + Intergenic
948618322 2:239215760-239215782 GGAGCCCGGTGCAGAGGCGCTGG - Intronic
948923966 2:241082119-241082141 GAAGCCAGCTGCAGACCCCCGGG + Intronic
949051363 2:241899222-241899244 GCTTCCAGCTGCAGAGGCGCGGG + Intronic
1168771209 20:417995-418017 GCAAGCAGGGGCAGAGCCCCTGG + Intronic
1169022382 20:2339799-2339821 GCAGGCAGGGGCTGAGCAGCTGG + Intronic
1169327142 20:4685526-4685548 ACAGCCAGGTGCAGTGGCTCAGG - Intergenic
1169978166 20:11353689-11353711 ACAGGCAGGTGCAGAGGCTCAGG - Intergenic
1170732300 20:18985726-18985748 GTAGCCACATGCAGAGCCACGGG - Intergenic
1173458524 20:43223217-43223239 GCAGCGAGGTCCAGAGCCCCTGG + Intergenic
1174000978 20:47374479-47374501 TTAGCCAGGTGCAGTGCCACAGG - Intergenic
1174293461 20:49525842-49525864 GCAGCCAGGTTTAGAATCGCTGG - Intronic
1175959946 20:62630962-62630984 GCAGCTTGGTGCTGAGCTGCAGG - Intergenic
1176164333 20:63664869-63664891 TCAGCCTGGGGCAGAGCCTCTGG + Intronic
1177031143 21:15983111-15983133 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1177119597 21:17123884-17123906 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1177840716 21:26231359-26231381 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1177903429 21:26946090-26946112 GCAGCCAGTTCCAGAGTAGCTGG + Intronic
1179837927 21:44049741-44049763 GCAGCCAGGGGCAGGGCATCAGG - Intronic
1180023395 21:45143612-45143634 GGTCCCATGTGCAGAGCCGCTGG + Intronic
1180455529 22:15510899-15510921 GCAGCCGGCTCCGGAGCCGCGGG - Intergenic
1180877895 22:19183581-19183603 GCAGCATGCTGCAGAGTCGCGGG - Exonic
1180908893 22:19434502-19434524 GCAGCCGGGTGCAGTGGCTCAGG - Intronic
1180935089 22:19620204-19620226 TCAGCCAGGTGCAGTGGCTCAGG - Intergenic
1183263407 22:36810902-36810924 CCAGCCAGAGGCAGAGGCGCAGG - Intronic
1183301443 22:37060987-37061009 GGAGCCAGCTGCAGAACCGGGGG + Intronic
1184008980 22:41732500-41732522 TCAGCCATGTGCAGAGATGCTGG + Exonic
1184927191 22:47651238-47651260 GGAGGCGGGTGCAGAGCAGCTGG + Intergenic
1185208709 22:49554791-49554813 GCAGACAGGTGCAGAGCCACAGG + Intronic
1185388273 22:50546497-50546519 GCAGCGAGGGGCAGAGCCCAGGG + Intergenic
950655270 3:14432570-14432592 GCACCCTGGAGCAGAGCTGCAGG + Intronic
950921465 3:16698775-16698797 ACAGCCAGGTGGAGAGCCAGTGG + Intergenic
953962595 3:47278688-47278710 GCAGCCAGGTGCGGTGGCTCAGG + Intronic
954430485 3:50468191-50468213 GCTGCCATGTCCAGAGCCGGAGG - Intronic
954797515 3:53169017-53169039 GAAGACAGGTGCAGAGCCTGGGG + Intronic
955708051 3:61748923-61748945 GCAGCGCAGTGCAGATCCGCAGG + Exonic
955804896 3:62723762-62723784 GCTGCCAGGCTCAGAGCAGCAGG - Intronic
956322035 3:68007957-68007979 GCAGCCTGGTGCAGGCGCGCGGG - Intronic
956763725 3:72466208-72466230 GCAGCCACGTGCCTAGCCCCAGG - Intergenic
961359362 3:126357333-126357355 GCGGCCGGGGGCCGAGCCGCGGG + Exonic
963319775 3:143799673-143799695 GCAGCCACTCCCAGAGCCGCTGG + Intronic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
964300220 3:155278502-155278524 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
964984840 3:162725843-162725865 GCAGCCACTTTCAGAGCCCCTGG - Intergenic
965105203 3:164345439-164345461 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
966595713 3:181723294-181723316 TCAGCCAGCGGCAGGGCCGCGGG - Intergenic
968289595 3:197528228-197528250 GCAACAAGGAGCAGAGCCGTGGG + Intronic
968366204 3:198186110-198186132 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
968463792 4:739587-739609 GCACCCAGGTCCACTGCCGCAGG - Intronic
968583411 4:1405155-1405177 GCCTCCAGGCGCAGAGCCGGTGG + Intronic
968867350 4:3221974-3221996 GCAGCCAGCTGCACAGTCTCAGG + Intronic
968940193 4:3633670-3633692 CCAGGCCGGTGCAGAGCAGCAGG - Intergenic
969423159 4:7108874-7108896 GCAGCCAGGGCCAGACCAGCGGG - Intergenic
969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG + Exonic
971552678 4:27976354-27976376 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
971714148 4:30153646-30153668 GCAGCCAGGTGCTGTCCTGCAGG - Intergenic
973992974 4:56429975-56429997 CCAGCCAGGTGCAGTGGCTCAGG + Intronic
974121166 4:57640614-57640636 GCAGGCAGGTGCAGAGGCCTGGG - Intergenic
974550180 4:63362559-63362581 GCGGCCAGGTGCAGAGGCCGGGG + Intergenic
975420496 4:74158296-74158318 GGCGCCGGGTGCGGAGCCGCTGG + Intronic
979333713 4:119444746-119444768 GCAGCCGGGTGCAGTGATGCAGG + Intergenic
980574403 4:134666522-134666544 GCAGCTCGGTGCAGGGCTGCAGG - Intergenic
980944519 4:139305813-139305835 GCAGCCAGGAGCAGTGGCTCAGG - Intronic
983460031 4:168016023-168016045 GCAGCCGGGTGCAGTGGCTCAGG - Intergenic
983715571 4:170777208-170777230 CAAGCCAGGTGCAAAGCAGCAGG - Intergenic
986733723 5:10653210-10653232 GCAGCCATGAGCACAGCTGCAGG - Intergenic
988860081 5:35268370-35268392 GCAGCCAGGTGCGGTGGCTCAGG - Intergenic
989992871 5:50788986-50789008 GCAGCCTGGAGCAGAGCAGCAGG - Intronic
991174204 5:63667848-63667870 GCAACCATGTGCAGAGGCACTGG + Intergenic
991961656 5:72050835-72050857 GCAGCCAGGTGCAGTGGTCCAGG - Intergenic
991980643 5:72226892-72226914 GCAGCCAGGTTCTGTGCCACAGG - Intronic
992042299 5:72848189-72848211 GCTGCCAGGAGCAGTTCCGCCGG + Intronic
993983055 5:94565621-94565643 GCAGCCAGGTGCGGTGGCTCAGG - Intronic
994558170 5:101331119-101331141 CCTGGCAGGTGCAGAGCTGCAGG - Intergenic
996528080 5:124499441-124499463 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
997315480 5:132931132-132931154 GCAGCCGGGTGCAGTGGCTCAGG + Intronic
997402271 5:133612207-133612229 GCAGCAAGATGCGGGGCCGCGGG + Intronic
998386258 5:141758712-141758734 GCCCGCAAGTGCAGAGCCGCAGG - Intergenic
998996370 5:147872296-147872318 GCAGCCACTCGCAGAGCCCCCGG - Intronic
1000885291 5:166742415-166742437 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1001978063 5:176016976-176016998 GTGGCCAGGTGCAGTGCCTCAGG - Intronic
1002239356 5:177826786-177826808 GTGGCCAGGTGCAGTGCCTCAGG + Intergenic
1002510552 5:179713633-179713655 GGAGCCAGGTGCAGTGGCTCAGG + Intronic
1002586798 5:180253639-180253661 GCTTCCAGGTGCAGGGCCACAGG + Intronic
1002725429 5:181291335-181291357 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
1002772863 6:304286-304308 GCAGCAGAGTGCAGAGCTGCAGG + Intronic
1002797733 6:488310-488332 GCAGCCACGTGCAGGGCGGGTGG + Intronic
1003342799 6:5238024-5238046 GCAGCCAGGAGCACGGCCTCAGG - Intronic
1003559842 6:7171354-7171376 AAAGCCAGGTGCAGAGCATCTGG + Intronic
1004283492 6:14300275-14300297 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1005503697 6:26451742-26451764 GCAGCGTGCTGAAGAGCCGCGGG + Exonic
1005923229 6:30418587-30418609 CCAGTCAGGTGCAGACCCGGTGG + Intergenic
1006635463 6:35458350-35458372 GCAGCCAGGTGCAGAGCCGCAGG - Exonic
1006740132 6:36302138-36302160 GCAGCCACCTGCACAGCCACTGG + Exonic
1007706621 6:43795210-43795232 GCAGCCAGGAGCCGAGCCTGGGG - Intergenic
1008034899 6:46735302-46735324 GCAGCCAGGGGGACAGCGGCTGG - Exonic
1010071695 6:71751871-71751893 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1011253684 6:85399843-85399865 TCAGCCATGTGCAGGGCTGCTGG - Intergenic
1011551609 6:88535616-88535638 GCAGACAGCTGCAGAACCACAGG - Intergenic
1013359799 6:109383089-109383111 GCCGCCCGGATCAGAGCCGCAGG + Intergenic
1013459075 6:110358173-110358195 GCAGCTCTGCGCAGAGCCGCAGG + Exonic
1014718925 6:124894423-124894445 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1014793960 6:125705185-125705207 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1015864376 6:137712821-137712843 TCTGCCTGGTGAAGAGCCGCTGG + Intergenic
1016629001 6:146205889-146205911 GCAGGCATGTGCAGAGTCACAGG + Intronic
1018998410 6:168727431-168727453 GCATCCTGGTGCAGAGCTGTGGG - Intergenic
1019272640 7:159019-159041 GCAGGGAGGTGCAGTGCTGCGGG + Intergenic
1019421669 7:953877-953899 GCAGCCAGGTGCAGGGAGCCGGG + Intronic
1019656847 7:2200424-2200446 ACAGCCAGGTGCTGAGGAGCAGG - Intronic
1020711625 7:11613403-11613425 ACAGCCAGGTTCAGAGCTGCTGG - Intronic
1021202385 7:17741377-17741399 TCTGCCTGGTGCAGAGCAGCAGG - Intergenic
1021637345 7:22705630-22705652 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1021959588 7:25858619-25858641 GCAGCCCGCTGCAGGGGCGCAGG + Intergenic
1022197847 7:28086278-28086300 GCAGCCAGGTGCAGCTGAGCTGG + Intronic
1022208367 7:28184403-28184425 GCAGCCAGGTGGAGAGCTAGGGG - Intergenic
1022709099 7:32834766-32834788 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1022977857 7:35575236-35575258 GCAGGCATGTGCAGGCCCGCAGG - Intergenic
1024070331 7:45778936-45778958 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
1024600212 7:50974002-50974024 CCTGCCAGGTGCTGAGGCGCAGG + Intergenic
1024981466 7:55161035-55161057 GCAGCCTGGAGCAGAGCTGGTGG - Intronic
1028690205 7:93642247-93642269 GCAGCCACTTCCAGAGCCCCTGG + Intronic
1028696242 7:93716493-93716515 GCGGCCAGGTGCAGTGGCTCAGG + Intronic
1029238269 7:99142082-99142104 GCAGCCTGGTCCAGAACCTCTGG + Intronic
1029500238 7:100924556-100924578 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1029700748 7:102245391-102245413 GCACCCAAGTGCAGTGCTGCTGG + Intronic
1031920007 7:127593579-127593601 GGAGGCGGGTGCAGAGCCTCCGG - Intronic
1032047736 7:128623237-128623259 GCAGCCAGGTGCAGTGGTGCAGG - Intergenic
1033209576 7:139450987-139451009 GCAGCCATATGGAGAGCCGCAGG + Intergenic
1034296119 7:149973819-149973841 GCAGCCAGGGACAGATCCTCGGG - Intergenic
1034457865 7:151181202-151181224 GCAGCAAGCTGCACAGCTGCAGG + Exonic
1034809913 7:154122990-154123012 GCAGCCAGGGACAGATCCTCGGG + Intronic
1034869490 7:154671304-154671326 GAGGCCAGGTGCAGAGCTGTGGG - Intronic
1034950801 7:155296207-155296229 GGAGCCCAGTGCAGAGCAGCTGG + Intergenic
1035209023 7:157314153-157314175 GCAGCCGCGGGCAGAGCCACAGG - Intergenic
1035559175 8:592429-592451 GCAGCTGGGTGCAGAGCCTCGGG - Intergenic
1036664695 8:10730747-10730769 GCAGCCGGGCGCAGATCCCCGGG - Intronic
1037462151 8:19121858-19121880 CCAGCCAGGTGCAGTGGCTCAGG - Intergenic
1038311649 8:26449809-26449831 GCGGCCACGAGCAGCGCCGCGGG - Intronic
1038538712 8:28373529-28373551 GCAGCCTGGAGAAGAACCGCAGG + Intronic
1039110740 8:34038620-34038642 GCAGCCAGGTGCAGTGGCTCAGG - Intergenic
1039387705 8:37151073-37151095 GCAGCCAGGTCCAGAGCTCTGGG + Intergenic
1041507767 8:58620268-58620290 ACAGCCAGGTGCAGAGAAGGAGG + Intronic
1042271551 8:66961568-66961590 GCAGCCGGGTGCAGACCCTGCGG - Exonic
1044430515 8:92102270-92102292 GCAGGCAGGCGCAGAGCGCCTGG + Intronic
1044973426 8:97642027-97642049 CCAACCCGGTGCAGAGCTGCAGG + Intergenic
1045359116 8:101415457-101415479 GCAGCCAGGGACAAAGCAGCGGG - Intergenic
1046174637 8:110559752-110559774 ACAGACAGGTGCAGAGGCCCAGG + Intergenic
1046660001 8:116938621-116938643 TCCTCCAGCTGCAGAGCCGCTGG + Intronic
1049010528 8:139884288-139884310 GCACCCAGGAGCAGAGCCCTGGG - Intronic
1049154564 8:141058976-141058998 GGAGGTAGGTGCAGAGCCTCCGG + Intergenic
1049572438 8:143375581-143375603 GCGGCCAGCTGCAGAGCCGCAGG + Exonic
1049587565 8:143439069-143439091 GCAGCCAGTTCCAGAGCCAGTGG - Intronic
1049738846 8:144224858-144224880 GCAGGCAGGTGCAGGGCCACTGG + Intronic
1051835383 9:21331730-21331752 GAAGCCAGCTACAGAGCCTCTGG - Exonic
1052720613 9:32167835-32167857 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1054450563 9:65401627-65401649 CCAGGCCGGTGCAGAGCAGCAGG + Intergenic
1055081982 9:72276439-72276461 GCAGCAAGGTGGGGAGCCTCTGG - Intergenic
1056705969 9:88953065-88953087 GCAGCCTGGTGCAGAGTGGAGGG - Intergenic
1057230159 9:93317107-93317129 GCTGGCAGGAGCAGAGCCCCAGG - Intronic
1058452854 9:105113301-105113323 GCAGCCGGGTGCAGTGGCTCAGG + Intergenic
1059232431 9:112733560-112733582 GCAGCCAGGTGCAGTGGCTCAGG + Intergenic
1059337815 9:113580195-113580217 GCACCCAGGTGCGGGGCCTCAGG + Intronic
1059546132 9:115177943-115177965 GCAGCCACTTCCAGAGCCCCTGG - Intronic
1059872854 9:118597105-118597127 GCAGCCAAGTGGGGAGCCCCTGG - Intergenic
1060979693 9:127785343-127785365 GCAGCCAGGTGCCGAGCGCGGGG + Intergenic
1061393894 9:130332912-130332934 GCATCCAGGAGCAGGGCCGGCGG - Intronic
1061420598 9:130471237-130471259 CCAACCACGTGCAGAGCCCCGGG + Intronic
1061572597 9:131487072-131487094 GCAGCCATGTGGAGAGGGGCAGG + Intronic
1061687134 9:132290611-132290633 ACAGCCAGGTGCAGCGGCTCAGG + Intronic
1061893106 9:133633197-133633219 GAAGCCAGGCGCTGAGCAGCAGG + Intergenic
1062006241 9:134239875-134239897 GCAGCCCGAGGCAGAGCCGTGGG + Intergenic
1062227644 9:135462388-135462410 CCAGCCAGGTGGAGAGTGGCGGG + Intergenic
1062718767 9:138023923-138023945 GCTGCCATGTCCAGAGCCGTCGG + Intronic
1062750572 9:138248976-138248998 GCAGCCGGGTGCAGTGGTGCAGG - Intergenic
1185870340 X:3659462-3659484 GCAGCAAGGTGGAGAGCAGAAGG - Intronic
1186555103 X:10549791-10549813 GCAGCCAGGTTGAGAACCACTGG + Intronic
1187103739 X:16220144-16220166 GCAGCCACTCCCAGAGCCGCTGG - Intergenic
1187400295 X:18953703-18953725 GCAGCCAGGTGCGGTGGCTCAGG + Intronic
1187457791 X:19458149-19458171 GCATCAAGGCGCAGAGCCACAGG - Intronic
1188637162 X:32448479-32448501 TCAGCCTAGTGCAGAGCCACTGG + Exonic
1189988422 X:46573809-46573831 GCCGGGAGGAGCAGAGCCGCGGG - Exonic
1194863357 X:99032899-99032921 GCAGCCAGGTACAGAGAAACAGG + Intergenic
1195210765 X:102651268-102651290 GCAGCCTGGTGCCAACCCGCAGG + Intergenic
1195221058 X:102745846-102745868 GCAGCCTGGTGCCAACCCGCAGG + Intronic
1195701649 X:107710206-107710228 GAAGCCAGGGGCAGGGCCTCTGG - Intergenic
1195714490 X:107805313-107805335 GCAGCCAGGTGCAGTGGCTCAGG - Intergenic
1196220954 X:113112040-113112062 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1196846562 X:119900816-119900838 GCAGCCGGGTGCAGTGGCTCAGG - Intronic
1196992658 X:121346311-121346333 GCAGCCACTTCCAGAGCCCCTGG - Intergenic
1197470991 X:126865491-126865513 GCAGCCACTTCCAGAGCCCCTGG + Intergenic
1199952338 X:152716055-152716077 GCATCCAGGTGGAGAGCCTGAGG + Exonic
1199957345 X:152752393-152752415 GCATCCAGGTGGAGAGCCTGAGG - Exonic
1200033219 X:153312705-153312727 GGAGCCAGGAGCAGGGCAGCTGG + Intergenic
1200793706 Y:7321625-7321647 GCAGCAAGGTGGAGAGCGGAAGG + Intergenic