ID: 1006636695

View in Genome Browser
Species Human (GRCh38)
Location 6:35466377-35466399
Sequence GCCCTTCAGGAAGCTGGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006636695_1006636701 25 Left 1006636695 6:35466377-35466399 CCATCACCAGCTTCCTGAAGGGC 0: 1
1: 0
2: 0
3: 31
4: 490
Right 1006636701 6:35466425-35466447 GAGCCCTAGCCTGAGGATAAAGG 0: 1
1: 0
2: 2
3: 16
4: 118
1006636695_1006636700 18 Left 1006636695 6:35466377-35466399 CCATCACCAGCTTCCTGAAGGGC 0: 1
1: 0
2: 0
3: 31
4: 490
Right 1006636700 6:35466418-35466440 TTGTCTTGAGCCCTAGCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006636695 Original CRISPR GCCCTTCAGGAAGCTGGTGA TGG (reversed) Exonic
900658495 1:3771921-3771943 ACCCCTCTGGAAGATGGTGAGGG + Intergenic
900662510 1:3791998-3792020 GCCCTTCAGGAGGCTGAGGCGGG - Intronic
900941596 1:5802040-5802062 GCTCATCAGGAAGCTGCTGTGGG - Intergenic
901042486 1:6373751-6373773 GCCCTTCAGGAGGCTGAGGCAGG + Intronic
901199390 1:7458045-7458067 CCCAGACAGGAAGCTGGTGAGGG - Intronic
901248132 1:7749850-7749872 GCCCTCCCTGTAGCTGGTGATGG - Intronic
901306706 1:8238111-8238133 GCCCTTATGGAATCTGGGGATGG + Intergenic
901449137 1:9325467-9325489 CCTCTTCAGGAAGGTGGTGTGGG + Intronic
901521440 1:9788006-9788028 GCACTTTAGGAAGCTGAGGAAGG + Intronic
901906172 1:12413581-12413603 GCCATTCAGGAGGCTGGAGGAGG - Intronic
902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG + Intergenic
903205105 1:21775794-21775816 GCTATTCAGGAAGCTGAGGAAGG + Intronic
903733951 1:25517987-25518009 TCCCTTGAGGAAGGTGGGGAAGG + Intergenic
903760897 1:25698067-25698089 GCACTTGAGGCAGCTGGTGTGGG - Intronic
903871372 1:26437397-26437419 GCACTTCGGGAGGCTGATGAAGG + Intronic
904724259 1:32534902-32534924 GCACTTCAGGAGGCTGGGGTGGG + Intronic
904886046 1:33739180-33739202 CTCCTTCAGGACGCAGGTGATGG + Exonic
905042130 1:34968499-34968521 GCCACTCAGGAAGCTGATGTGGG - Intergenic
905953740 1:41974911-41974933 GCCCTTCAGGACTGAGGTGAAGG + Intronic
907121389 1:52011107-52011129 GCACTTCAGGAGGCTGGGGCTGG + Intergenic
908721641 1:67132271-67132293 GCACTTCAGGAAGCTGAGGCAGG + Intronic
908740522 1:67322757-67322779 TCCCTTCAGGCAGCTGCTGGGGG + Intronic
909962324 1:81861640-81861662 GCCCTTCAGGAGGCTGAGGCAGG + Intronic
910986201 1:93007430-93007452 GCTACTCAGGTAGCTGGTGAAGG - Intergenic
911121584 1:94302237-94302259 TCCCTCCTGGAAGATGGTGATGG - Intergenic
911329634 1:96512096-96512118 GCCATTCAGGAAGCTGAGGCAGG + Intergenic
912501143 1:110122542-110122564 GCTCTTCAGGGTGCTGGTGGGGG - Intergenic
914428474 1:147599816-147599838 GCCCTGCGGGAAGCTGGGGGCGG + Intronic
915378851 1:155422759-155422781 GCTCTTCAGGAAGCTGAGGCAGG - Intronic
915621880 1:157091224-157091246 GCTCCTCAGGAAGGTGGTGATGG - Intergenic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
916929934 1:169566316-169566338 GCCCTTAGGGGAGCTTGTGAAGG - Intronic
917719268 1:177770556-177770578 GGCCTTCAGGAGGCAGGAGAGGG + Intergenic
918010372 1:180581092-180581114 GCTCTTCAGGAAGCTGAGGCAGG + Intergenic
920336167 1:205246864-205246886 GCACTGTCGGAAGCTGGTGAAGG + Intronic
920352269 1:205344939-205344961 CCCCTTCCTGAAGCTCGTGAAGG - Intronic
921912993 1:220572487-220572509 GCACTTCAGGAGGCTGAGGAGGG - Intronic
922656261 1:227386832-227386854 GCACTTCAGGAGGCTGAAGAAGG + Intergenic
922870822 1:228900511-228900533 TCACTTCAGGAAGCTGGAAAAGG - Intergenic
923177934 1:231486304-231486326 GCACTTTAGGAGGCTGGGGATGG + Intergenic
923561795 1:235047354-235047376 GCACTTCGGGAAGCTGAGGAGGG - Intergenic
923920613 1:238560426-238560448 GCCACTCAGGAAGCTGAGGAGGG - Intergenic
924732355 1:246724046-246724068 GCCCTGCTGGAAGCTGGAGGCGG - Exonic
1063077675 10:2733025-2733047 GGCCTTCAGGAAGCAGGAGATGG - Intergenic
1063996104 10:11621359-11621381 GCTCCTCAGGAAGCTGATGCAGG + Intergenic
1064377600 10:14810836-14810858 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1066757781 10:38728271-38728293 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1067775816 10:49164206-49164228 GCCCTTTGGGAAGTTGGTGGGGG - Intronic
1069569570 10:69486170-69486192 GCCCCACAAGAAGCTGGTGGTGG + Intronic
1070046781 10:72846287-72846309 GCACTTCGGGAAGCTGATGCAGG - Intronic
1070197219 10:74169105-74169127 GCCGCTCAGGAAGCTGGGGTGGG + Intronic
1070453545 10:76586289-76586311 GCACTTCGGGAAGCTGAGGAGGG - Intergenic
1071522802 10:86341413-86341435 GCCCTTCTGGAAACGTGTGAGGG - Intronic
1072070251 10:91908627-91908649 GCACTTCTGGAAGCAGGTGCTGG - Exonic
1072587119 10:96792453-96792475 GCACTTCAGGAAGCTGAGGTGGG - Intergenic
1072653822 10:97316893-97316915 GCACTTTAGGAAGCTGGGGTGGG + Intergenic
1072945610 10:99807563-99807585 CCTCTTCAGGAAGCTGATGCAGG - Intronic
1073125351 10:101145866-101145888 GCCCTGCGGCAAGCTGGTGGGGG + Intergenic
1073567285 10:104546004-104546026 GCCCTCATGGATGCTGGTGAGGG - Intergenic
1073670001 10:105577534-105577556 GCACTTTAGGAAGCTGTTGCAGG - Intergenic
1073989183 10:109243652-109243674 ACCCTTTAGAAAGCTGATGATGG - Intergenic
1075266250 10:121001608-121001630 GCCTTTCAGGATGGTGGTGAGGG - Intergenic
1075653374 10:124144968-124144990 GCCCTTCAGAAATCAGGGGAAGG + Intergenic
1076599639 10:131648823-131648845 GCCCTGGAGGAAGCTGGGGCAGG - Intergenic
1077018735 11:408066-408088 ACTCTTCAGAGAGCTGGTGATGG - Exonic
1077041041 11:523138-523160 GCCACTCAGGAGGCTGGGGAGGG - Intergenic
1077149321 11:1062410-1062432 GCCCTGAAAGAAGCTGGTGAAGG - Intergenic
1077299248 11:1839596-1839618 GCCCATCAGGTAGGTGGTGAGGG - Intronic
1077515840 11:3001664-3001686 GCACTTCAGCCAGCTTGTGAGGG + Intronic
1077880381 11:6344588-6344610 TCAGTTCAGGAATCTGGTGATGG - Intergenic
1078494390 11:11801384-11801406 GGGCTTGAGGAAGGTGGTGAAGG + Intergenic
1080442073 11:32303815-32303837 GCTACTCAGGAAGCTGATGAAGG + Intergenic
1080467305 11:32509691-32509713 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1080660287 11:34290593-34290615 GCACTTCAGGAAGCTGAGGTGGG + Intronic
1080960023 11:37147137-37147159 GCTCCTCAGGAAGCTGAAGAAGG + Intergenic
1082919111 11:58473119-58473141 GCCCTTTGGGAAGCTGAGGAGGG - Intergenic
1084317726 11:68355041-68355063 GCCCCTCTGGAAGGTGGAGATGG + Intronic
1084613516 11:70219217-70219239 GCCCTCCAGAAAGGTGGAGAAGG + Intergenic
1084877283 11:72142607-72142629 GGGCTTCAGGAAGCAGGAGAGGG - Intergenic
1084882445 11:72181410-72181432 GGGCTTCAGGAAGCAGGAGAGGG - Intergenic
1084963046 11:72727225-72727247 GCCATGCAGGCTGCTGGTGAGGG - Intronic
1085806635 11:79642938-79642960 GCTATTCAGGAAGCTGAGGATGG + Intergenic
1085908037 11:80788230-80788252 ACCCTTAAGGAACCTGGTGGGGG - Intergenic
1085980555 11:81718837-81718859 GCTCTTCAGTCAGCTTGTGATGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1087150466 11:94855068-94855090 GGCCTTTATGTAGCTGGTGAAGG + Intronic
1090212856 11:124935156-124935178 CCCATCCAGGAAGCTGGTGCTGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092547329 12:9463358-9463380 GCACTTCAGGAAGCTGAGGTAGG - Intergenic
1093733281 12:22590076-22590098 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1094587535 12:31791950-31791972 GCCCTTCCAGAGGTTGGTGAGGG - Exonic
1096416906 12:51422464-51422486 GCCCCTCAGGAAGCTGAAGTGGG - Intronic
1096518704 12:52172211-52172233 CACCTACAGGAAGCTGGTGGAGG - Exonic
1097391088 12:59014167-59014189 GCCCTCCAGGAGTCTGCTGATGG - Intergenic
1098831843 12:75373594-75373616 TCCCTGAAGGATGCTGGTGAAGG - Intronic
1099025230 12:77457207-77457229 GCAATTCAGGAAGCTGGTTATGG + Intergenic
1100359644 12:93864298-93864320 GCACTTCAGGAGGCTGAGGATGG - Intronic
1101136997 12:101754035-101754057 GCTCTTCAGGAAGCTGAGGTAGG + Intronic
1102884616 12:116512196-116512218 GCACTTCAGGAGGCTGATGCAGG - Intergenic
1102990551 12:117312667-117312689 GCACTTCAGGAGGCTGGGGTGGG - Intronic
1103348224 12:120265333-120265355 GCCCTTCTGGGAGATGGTGATGG + Intronic
1103605124 12:122080230-122080252 GCCCTGCAGAAAGCTCATGATGG + Intronic
1103849899 12:123925975-123925997 GCACTTCAGGAAGCTGATGTGGG + Intronic
1103988321 12:124781536-124781558 GCCCTACAGGAACCTGGCCAAGG + Intronic
1106539965 13:30681688-30681710 TACCTCCAGGGAGCTGGTGAGGG + Intergenic
1107410236 13:40151515-40151537 GCCCTTCGAGAAGCTGGGAATGG - Intergenic
1108193874 13:47972002-47972024 GCACTTCAGGAGGCCGATGAGGG + Intronic
1109594772 13:64536165-64536187 ACCTTTGAGGAAGCTGCTGATGG - Intergenic
1109715980 13:66222922-66222944 GCAGTTCAGGCAGCAGGTGATGG - Intergenic
1111600307 13:90464802-90464824 GCCCTTTAGGAGGCTGAGGAGGG - Intergenic
1112430535 13:99346702-99346724 GCCCCCCAGGAAGCTGGGGAAGG - Intronic
1112660461 13:101501856-101501878 CCACTTCAGGAAGCTGGTTAGGG - Intronic
1112783694 13:102929072-102929094 CCCCCTAAGGAAGCTGGAGAGGG - Intergenic
1113314024 13:109159761-109159783 GCCCTGCTGGACGCTGGAGAAGG + Intronic
1113568610 13:111337630-111337652 GCCATCCTGGAAGCTGGTTATGG + Intronic
1114040492 14:18673906-18673928 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
1114045529 14:18872419-18872441 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
1114118683 14:19647049-19647071 GCACTTCAGGAAGCTGAGGCAGG - Intergenic
1114447012 14:22796393-22796415 GCCTTTCAGGGTGCTGGTGGGGG - Intronic
1114756396 14:25264773-25264795 GCCCTTTGGGAGGCTGATGAGGG + Intergenic
1115102842 14:29723831-29723853 GCCCTTCTGGAGTCTGGTGCTGG + Intronic
1115220181 14:31051006-31051028 GCACTTCAGGAGGCTGGAGCGGG + Intronic
1115356359 14:32452561-32452583 GCACTTGGGGAGGCTGGTGAGGG + Intronic
1115756271 14:36528489-36528511 ACCATTCAGGAGGCTGGGGAAGG - Intergenic
1115775495 14:36710259-36710281 GCCACTCAGGAGGCTGGTGCAGG + Intronic
1116678455 14:47936262-47936284 GCACTTTAGGAAGCTGAAGAGGG + Intergenic
1116918119 14:50544987-50545009 ACCCTTCAGTAATCTGGTGAGGG - Intronic
1117343812 14:54813772-54813794 GTTCTTCAGGAAGGTGCTGATGG - Intergenic
1119036871 14:71237543-71237565 GGCCTTTAGAAAGCTTGTGAGGG - Intergenic
1119045344 14:71314137-71314159 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1119233346 14:72998737-72998759 GCACTTCAGGAGGCTGAGGAGGG + Intronic
1119668169 14:76499312-76499334 GCCCTTCAGGGAGAGGGGGAAGG - Intronic
1120162649 14:81162378-81162400 TGCCTTGAGGAAGCTGGTCAAGG - Intergenic
1120417186 14:84234334-84234356 GCCCTTTAGGAGGCTGGGGTGGG - Intergenic
1121330710 14:93047817-93047839 GCCCTGCAGGAAGCAGATGTCGG - Intronic
1123022774 14:105409622-105409644 GCACTTCAGGAGGCTGAGGAGGG - Intronic
1123105951 14:105841121-105841143 GCCCACCACGAAGCAGGTGAAGG + Intergenic
1123882647 15:24690090-24690112 GCCCCCCAGGAAACTGGAGAAGG + Intergenic
1124689473 15:31810103-31810125 GTTCTTCAGGCAGCTGGAGAAGG + Intronic
1124805506 15:32877963-32877985 TGCCTTCATGAAGCTGGTGGAGG + Intronic
1126053593 15:44709433-44709455 GCACTTTAGGAGGCTGGGGAAGG + Intronic
1126115231 15:45201901-45201923 GACTTTCAGGCAGCTGGTGGTGG + Intergenic
1129411783 15:75354411-75354433 GCCCTGCAGGACACTGGTGTTGG - Exonic
1129616513 15:77103255-77103277 GCTATTCAGGAAGCTGAGGAGGG - Exonic
1129981908 15:79880324-79880346 GCACTTCAGGAGGCTGAGGAAGG - Intronic
1130423157 15:83768590-83768612 GGCCTTCAGAAAGCTTGAGAAGG + Intronic
1130961711 15:88663821-88663843 GCTCTTTAGTAAGCAGGTGATGG - Intergenic
1131063724 15:89419953-89419975 GCCTATCAGGATGGTGGTGATGG + Intergenic
1131287982 15:91078111-91078133 GCCATTCAGGAAGCTGAGGCAGG - Intergenic
1131435186 15:92416489-92416511 GCCCCTCAGGATGCTGGGGTTGG - Intronic
1132134349 15:99320051-99320073 GCACTTCAGGAAGCTGAGAAGGG - Intronic
1132234237 15:100207095-100207117 GGCCTTCAGGGAGGTGATGAAGG + Intronic
1132306646 15:100819737-100819759 GCACCTTTGGAAGCTGGTGAAGG - Intergenic
1132781424 16:1628498-1628520 GCACTTCAGGAGGCTGGGGCAGG - Intronic
1133171177 16:3983324-3983346 GTACTTCAGGAAGCAGGTGGTGG + Exonic
1133317062 16:4891523-4891545 GCCATTCAGGAGGCTGGGGCAGG - Intronic
1133486864 16:6228062-6228084 GCCCTTTAGGAAGCTGAGGTGGG + Intronic
1133627977 16:7590017-7590039 GCCCTTTAGGAAGCTGAGGTGGG + Intronic
1133844758 16:9443510-9443532 GCTATTCAGGAAGCTGAAGAGGG + Intergenic
1133975952 16:10600079-10600101 GCCTTTCAGGAGGCTGAGGATGG + Intergenic
1134005503 16:10816443-10816465 GCCACTCAGGAGGCTGGGGAAGG - Intronic
1134675016 16:16084212-16084234 GCCCCTCAGGAAGCTGAGGCAGG - Intronic
1134884283 16:17776000-17776022 GCCCTTCTGGAAGGAGGTGCAGG - Intergenic
1135308516 16:21387465-21387487 GCACTTCAGGAAGCTGAGGGGGG + Intergenic
1135604635 16:23812751-23812773 GACCTTCAGGAATGTGGTAAAGG - Intergenic
1135699354 16:24618165-24618187 GCACTTTAGGAAGCTGATGCGGG - Intergenic
1135795458 16:25436951-25436973 TCCCTTTAGAAAGATGGTGAAGG - Intergenic
1136148098 16:28327769-28327791 GCACTTCAGGAAGCTGAGGGGGG + Intergenic
1136233328 16:28900508-28900530 CCCCTGGAGGAAGCTGGTGGGGG - Intronic
1136305259 16:29366598-29366620 GCACTTCAGGAAGCTGAGGGGGG + Intergenic
1136594051 16:31234831-31234853 GCACTTCAGGAGGCTGAGGAGGG + Intergenic
1137803568 16:51283407-51283429 GGCCTTGAGTAAGCTGGTGGGGG - Intergenic
1138519220 16:57561444-57561466 GCCTCTCAGGAAGCTGCTGGAGG - Intronic
1138952606 16:61931649-61931671 GCCCCTCAGAAAGATTGTGAGGG + Intronic
1139301290 16:65947506-65947528 GCCCTTGGGGAGGCTGATGAGGG + Intergenic
1139553050 16:67686722-67686744 GCTCTTCAGGAAGCTGAGGAAGG + Intronic
1141249876 16:82345656-82345678 TCCCTTCAGCAGTCTGGTGAAGG + Intergenic
1141716309 16:85729076-85729098 GCCCTGCTGGAACCTGGAGAGGG + Intronic
1142764438 17:2057509-2057531 GCCCTTCCAGAAGCTGGAGGAGG + Exonic
1142782996 17:2196173-2196195 GCACTTCAGGAAGCTGAAGCGGG + Intronic
1143172655 17:4939086-4939108 TGCCTTCAGGATACTGGTGAGGG + Exonic
1143300355 17:5905221-5905243 AACCTAAAGGAAGCTGGTGAAGG + Intronic
1144621706 17:16822445-16822467 GCCCTTCATGGAGCTGGAGGAGG + Intergenic
1144884714 17:18450269-18450291 GCCCTTCATGGAGCTGGAGGAGG - Intergenic
1145018429 17:19413271-19413293 CCCCTGCAGGAGTCTGGTGAGGG + Exonic
1145036459 17:19544188-19544210 GCACTTCAGGAAGCTGAGGAGGG - Intronic
1145147513 17:20494108-20494130 GCCCTTCATGGAGCTGGAGGAGG + Intergenic
1147283564 17:39382584-39382606 ACACTTCAGGAAGCTGATGTGGG + Intronic
1147361532 17:39933817-39933839 TCCCTTCAGGAAGCAGGTGGGGG - Intergenic
1147468135 17:40628387-40628409 GACTTTCAGGAAGCTACTGATGG + Exonic
1147573692 17:41586787-41586809 GCCCTTCATGGAGCTGGAGGAGG + Exonic
1147577807 17:41612641-41612663 GCCCTTCATGGAGCTGGAGGAGG + Exonic
1147677362 17:42217370-42217392 CCACTTCAGGAATATGGTGAGGG - Exonic
1147758538 17:42783258-42783280 GCCCTTTAGGAGGCTGCTGCAGG - Intronic
1147953021 17:44117526-44117548 GGCCTGCAGGAAGCTGGCGTTGG + Exonic
1148841062 17:50497540-50497562 GCACTTCGGGAAGCTGAGGAAGG + Intergenic
1149791412 17:59480819-59480841 GCACTTCTGGAAGCTGAGGAGGG + Intergenic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1150310154 17:64121731-64121753 GCACTTCAGGAAGCTGAGGCGGG - Intronic
1150486274 17:65546071-65546093 GCCCTGCTGGGAGCTGGGGAGGG - Intronic
1150597779 17:66622075-66622097 GCTCTTCAGGAAGCTGAGGCAGG + Intronic
1150828992 17:68501702-68501724 GCACTTTAGGAAGCTGAGGAGGG - Intergenic
1150907893 17:69358092-69358114 GTTCTCCAGGATGCTGGTGATGG + Intergenic
1151579846 17:74971844-74971866 GGCCCTCAGTCAGCTGGTGAGGG - Intronic
1151707558 17:75778872-75778894 GCCCTTCCAGAGGTTGGTGAGGG - Exonic
1151821603 17:76499932-76499954 GCCCTGCAGGAAGCTGGTCTAGG - Intronic
1151967188 17:77437551-77437573 GCCCCTCAGGGACCAGGTGAGGG + Intronic
1152160866 17:78667875-78667897 GCCCTTAAGTAACCTGGTGGAGG - Intergenic
1152294763 17:79460352-79460374 GCCTTTTAGGAAGCTGCTGCTGG - Intronic
1152686406 17:81695850-81695872 GCGGTTCACGAAGGTGGTGACGG - Exonic
1152808169 17:82367997-82368019 GCCTATGAGGAAGCTGGGGAGGG - Intergenic
1152873512 17:82772350-82772372 GGCCCTCGGGGAGCTGGTGAGGG + Intronic
1153922820 18:9806425-9806447 GGCCTTGAGGATGCTGGTGGAGG + Intronic
1156237195 18:35216923-35216945 GCCCCCCAGGAAAGTGGTGAAGG - Intergenic
1156518357 18:37699907-37699929 GCCCTGCAGCAGGCTGGAGATGG + Intergenic
1158359345 18:56653972-56653994 CACCTGCAGGAAGCTCGTGAGGG + Intronic
1159554102 18:69927133-69927155 GCCCTTCAGAAAGATGTTGAAGG + Intronic
1160130078 18:76217848-76217870 GCACTTCAGGAAGCTGAGGTGGG + Intergenic
1160689661 19:455741-455763 GCCCCTCAGGACGCTGGGAAAGG - Intronic
1160832636 19:1110860-1110882 GCGGTTCAGGAACTTGGTGATGG + Exonic
1161100694 19:2419824-2419846 GCCCTTCAGAAATCTGGGCATGG - Intronic
1161861015 19:6798379-6798401 CCCCTTTGGGAAGCTGGTGTGGG + Intronic
1161973916 19:7598381-7598403 GCCCTTCAGGCCCCTGGTTATGG + Intronic
1161996245 19:7713519-7713541 GCTTCTCAGGAAGCTGGGGAGGG + Intergenic
1162073677 19:8170475-8170497 GCACTTCAGGAAGCTGAGGTGGG - Intronic
1162085666 19:8247529-8247551 GCTATTCAGGAAGCTGATGTGGG - Intronic
1162592256 19:11599563-11599585 GCCCTTCAGTGAGCAGGTTAGGG + Intronic
1162973735 19:14196370-14196392 GCACTTCAGGAGGCTGAAGAGGG + Intronic
1163635668 19:18436191-18436213 GCCCTCCAGGATGCTGGCCACGG + Exonic
1163995207 19:21039193-21039215 GCACTTCAGGAGGCTGGTGTGGG - Intronic
1164254767 19:23517915-23517937 GTGCTTCAAAAAGCTGGTGAGGG + Intergenic
1164753147 19:30670750-30670772 GCCCTTCAGGCAGGTTCTGAAGG + Intronic
1165205174 19:34177912-34177934 GCACTTCAGGAAGCTGAGGCAGG + Intronic
1165821768 19:38681298-38681320 GCCAGTCAGGAGGCTGCTGAGGG - Intronic
1166007006 19:39914964-39914986 GCACTTCAGGAAGCTGAGGCGGG + Intronic
1166275215 19:41748958-41748980 CACCTTCAGGAAGGTGGTCAGGG - Intronic
1166352256 19:42204971-42204993 CTCCATCAGGAAGCAGGTGATGG - Intronic
1167192589 19:48001941-48001963 GCACTTCAGGAAGCTGACGCAGG - Intronic
1167732245 19:51266929-51266951 GCCAGGCAGGAAGCTGGTGCAGG + Intronic
1167784941 19:51629042-51629064 GCCGTTCCTGAAGATGGTGATGG + Exonic
1167948435 19:53008012-53008034 TCCCTGCAGGAGGCTTGTGAAGG + Intergenic
1168058013 19:53874233-53874255 CCCCGACAGGAAGCTGGGGAAGG - Exonic
1168300727 19:55403375-55403397 GCCATTCAGGAAGCTGAGGCAGG + Intronic
925384634 2:3453525-3453547 TCCCTGCTGGAAGCTGCTGAGGG - Intronic
925406574 2:3609479-3609501 GCCACTCAGGAAGCTGATGTGGG - Intronic
925595852 2:5555102-5555124 GCACTTCGGGAAGCTGAGGAGGG - Intergenic
925698967 2:6613760-6613782 GCTCTTTAGTAAGCAGGTGATGG + Intergenic
926063612 2:9820325-9820347 CTCCTTCAGGAAGCTGGGGGTGG + Intergenic
926184620 2:10679418-10679440 GCCACTCAGGAAGCTGAGGAAGG + Intronic
927182135 2:20454201-20454223 GCACTTCAGGAAGCTGAAGTGGG + Intergenic
927190010 2:20511087-20511109 GCCCTTTAGGAGGCTGGTGGAGG - Intergenic
927872285 2:26631226-26631248 GCCCTTCAGGAGGCTGAGGCGGG + Intronic
927925536 2:27010872-27010894 GCCCAGGAGGAAGCTGGAGAGGG - Intronic
928915375 2:36464758-36464780 GCCCTTCAGCAAGCCCCTGAAGG - Intronic
930657339 2:54019316-54019338 GCACTTCAGGAAGCTGAGGCAGG - Intronic
931287574 2:60845640-60845662 GCCCCTCAGGAAGCTGAGGCAGG - Intergenic
931400620 2:61928009-61928031 GCACTTCAGGAGGCTGAGGAGGG - Intronic
932088491 2:68783707-68783729 GCACTTCAGGAAGCTGAGGCAGG - Intronic
932480460 2:72036100-72036122 CCCCTGCAGGAAGCTTCTGAGGG - Intergenic
933810675 2:86031113-86031135 TCCCTTTAGGAATCTGGTGATGG - Intronic
934102961 2:88670566-88670588 GCACTTCAGGAAGCTGAGGTGGG + Intergenic
935130751 2:100259142-100259164 CACCTTAAGGAAGCTGGTGCTGG + Intergenic
935321601 2:101894916-101894938 TGTCTTCAGGAACCTGGTGATGG - Intergenic
935793085 2:106612029-106612051 GTCCTTCAGCAAGCTGCTGAAGG + Intergenic
936978564 2:118242844-118242866 TCCCTTCAAGAATCTGATGAAGG + Intergenic
937251462 2:120526437-120526459 TCCCTTCTAGAAGCAGGTGATGG - Intergenic
938259875 2:129887923-129887945 GATTTTCAGGAAGGTGGTGATGG + Intergenic
938837624 2:135122973-135122995 GCACTTTGGGAAGCTGGGGAGGG - Intronic
939299979 2:140323153-140323175 GCTCTTCAAGATGCTGTTGAAGG - Intronic
939587569 2:144024087-144024109 GCCCTGCAGTAAACTGCTGAAGG + Intronic
940123140 2:150291140-150291162 GCTCTTCAGGAAGCTGAGGCAGG + Intergenic
940971634 2:159902978-159903000 CCGCTTCATGATGCTGGTGATGG - Intronic
941892447 2:170596270-170596292 GCCCCTCAGAAAGGTTGTGATGG - Intronic
942751040 2:179287641-179287663 GCCCTTCGGGAAGCTGAGGCAGG + Intergenic
944137270 2:196413241-196413263 GCCACTCAGGAAGCTGGCGTGGG + Intronic
945578697 2:211565308-211565330 GCCCTTCTGAAAGGTGGTGATGG + Intronic
946954673 2:224916292-224916314 GCACTTCAGGAAGCTGAGGTGGG + Intronic
947073725 2:226319116-226319138 GCCATCCAGGAAGTTGGGGAAGG + Intergenic
947416807 2:229905026-229905048 GCACTTCAGGAAGCTGAGGCAGG + Intronic
947508329 2:230727524-230727546 GCCACTCAGGAAGCTGAGGAGGG - Intronic
948048808 2:234964255-234964277 CACCTTCAGGAGGCTGGGGAGGG + Intronic
948080853 2:235203927-235203949 GCTATTCAGGAATCTGCTGAGGG + Intergenic
948377412 2:237530585-237530607 GCCCTCAAGGAAGTTGGTGCAGG - Intronic
1168838097 20:891182-891204 CACCCTGAGGAAGCTGGTGAAGG - Intronic
1169342022 20:4803810-4803832 GCACTTCAGGAAGCCGAGGAGGG + Intronic
1170219813 20:13930035-13930057 GCGCTTCAGGAAGCTGAGGTGGG - Intronic
1170533165 20:17314906-17314928 GCTCTTCAGGAATATGCTGATGG + Intronic
1170898096 20:20434687-20434709 GCACTTTAGGAAGCTGATGCAGG + Intronic
1170943287 20:20866992-20867014 ACACTTCAGGAAGCTGATGCGGG + Intergenic
1171444083 20:25191264-25191286 GCCCTGCAGGCAGAAGGTGAAGG - Intergenic
1172494694 20:35371757-35371779 GCACTTCAGGAAGCTGAGGCAGG + Intronic
1172613665 20:36269196-36269218 GGCCTGCAGGGAGCTGGTGGGGG + Intronic
1173573652 20:44095920-44095942 GCCTTTCAGGAAGCTGTAGGAGG + Intergenic
1173824376 20:46038025-46038047 GCCCTACAGGAAGGGGATGAAGG - Intronic
1174144844 20:48445312-48445334 GCACTTCAGGAGGCTGAGGAAGG + Intergenic
1174352968 20:49981592-49981614 GCCCTTCAGGTTGGTGGTGGTGG + Intergenic
1174708196 20:52678278-52678300 GCCCAGCAGGAAGCTGGAGGCGG - Intergenic
1175405002 20:58720171-58720193 GCCCTGCAGGAAGCTGGAGGAGG + Intergenic
1175583057 20:60115597-60115619 GTACTTCAGGAATCTGGGGACGG + Intergenic
1175619582 20:60431941-60431963 CCCCTTCAGGAAGGTGGAAATGG + Intergenic
1176145842 20:63565087-63565109 GCCCTTCCGGAGGCTGTAGATGG + Exonic
1176372460 21:6070600-6070622 GCCCTTCCGCAAGATGGGGATGG - Intergenic
1178100787 21:29266464-29266486 GCACTTCAGGAAGCTGAGGCAGG + Intronic
1178317826 21:31581636-31581658 GCACTTCAGGAGGCTGATGTGGG - Intergenic
1178527321 21:33342297-33342319 GCTATTCAGGAAGCTGAAGAGGG + Intronic
1179091361 21:38268916-38268938 GTCCCTAAGGCAGCTGGTGAAGG + Intronic
1180099574 21:45578269-45578291 GCCCTTCAGGGAGCCTGGGAGGG + Intergenic
1180464060 22:15595036-15595058 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
1181431444 22:22884161-22884183 GCACTCCAGGCAGCTGGTGGAGG + Intronic
1182027763 22:27134010-27134032 GCCTGACAAGAAGCTGGTGAGGG - Intergenic
1182280900 22:29217192-29217214 GGCCTTCAAGGAGTTGGTGAGGG + Intronic
1182961174 22:34476652-34476674 GCACTTCAGGAAGCTGAGGTTGG + Intergenic
1183185648 22:36290251-36290273 GCCACTCAGGAAGCTGATGTGGG + Intronic
1183448671 22:37877972-37877994 GAGCTTCAGGAAGCTGCGGATGG - Exonic
1183654896 22:39178949-39178971 GGCCTTCAGGGAGGAGGTGACGG + Intergenic
1183784707 22:40022688-40022710 GCCTTTCAGGTGGCTGGTGGCGG + Intronic
1184308900 22:43628405-43628427 GTCCTGCAGGAACCTCGTGATGG + Intronic
951016383 3:17736763-17736785 GCACTCCAGGAAGCTGGGGCGGG + Intronic
951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG + Intergenic
952677049 3:36045194-36045216 GCCTGTCAAAAAGCTGGTGAAGG - Intergenic
953565206 3:44026550-44026572 ACCCTCCAGGTAGCTGGTGGTGG - Intergenic
953836682 3:46352184-46352206 GCCCTTCAGGAGGCTGAGGCAGG + Intergenic
953904702 3:46862684-46862706 GCTGTGCAGGAAGCTGGTCATGG - Intronic
954009323 3:47621053-47621075 GCCCTTCAGGAGGCTGAGGTGGG + Intronic
954053438 3:48002086-48002108 GCCTTTCAGGAGGCTGGGGCAGG + Intronic
954093085 3:48301103-48301125 GCCCTCCAGGAAGCGAGTGGTGG - Intronic
954143616 3:48623008-48623030 GCACTTCAGGAAGCTGAGGTGGG + Intergenic
954184860 3:48909133-48909155 GCACTTCAGGAAGCTGAGGTGGG - Intergenic
954388367 3:50256182-50256204 GTCGTTCAGGTAGCTGGGGATGG - Exonic
954818762 3:53306468-53306490 GCACTTCAGGAAGCTGAGGCAGG + Intronic
955932446 3:64071260-64071282 GCCCTTCGGGAAGCTGAGGCGGG - Intergenic
956587845 3:70883104-70883126 GCCACTCAGGAAGCTGAGGAAGG + Intergenic
957865451 3:86017615-86017637 GCTCTTCAGGAAGCTGAGGTAGG + Intronic
958465791 3:94456301-94456323 GCACTTTAGGAAGCTGATGCAGG - Intergenic
958776921 3:98496547-98496569 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
959118531 3:102206278-102206300 GCTCTTCAGTTAGCAGGTGATGG + Intronic
959978971 3:112493746-112493768 GCACTTCAGGAAGCTGAGGAGGG - Intronic
960811528 3:121631709-121631731 GCCCTTAATGAAGCAGGAGAGGG + Exonic
961048468 3:123726029-123726051 GTCCTTCAGGACACTGGAGAAGG + Exonic
961054343 3:123775277-123775299 GCACTTCAGGAGGCTGTTGGGGG - Intronic
961511864 3:127408360-127408382 GCCCAGCAGGCAGCTGGTGCAGG + Intergenic
961857674 3:129889023-129889045 GCACTTTAGGAAGCTGAGGAGGG + Intronic
962534130 3:136311711-136311733 GCACTTTAGGAAGCTGAGGAGGG + Intronic
962989635 3:140566364-140566386 GGGCTCCAGGAAGCTGGAGAAGG - Exonic
963003325 3:140703657-140703679 GTGTCTCAGGAAGCTGGTGAAGG + Intergenic
963136679 3:141912012-141912034 GCCCTTGGGGAAATTGGTGAAGG + Intronic
965633242 3:170755226-170755248 ATCCAACAGGAAGCTGGTGATGG - Intronic
965862170 3:173160590-173160612 GCCCTCCAGGAAAGTGGAGAAGG + Intergenic
966807920 3:183820651-183820673 GCACTTCAGGAGGCTGGGGCGGG + Intronic
967677457 3:192317040-192317062 GCTCTTTAGTTAGCTGGTGATGG - Intronic
968449925 4:670486-670508 GCACTTCAGGAAGCTGAGGCGGG - Exonic
970003485 4:11387844-11387866 TCCCTGAAGGAAGCAGGTGAAGG - Intergenic
971217199 4:24672605-24672627 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
971308701 4:25505793-25505815 GCCCTCCAGGATGCTGGCCACGG - Intergenic
971375679 4:26053987-26054009 GGCCTTCAGGATGCTGAAGAAGG - Intergenic
971914589 4:32851412-32851434 GCTCTTCAGTTAGCAGGTGATGG + Intergenic
972521419 4:39860821-39860843 GCACTTCAGGAAGCTGAGGCAGG + Intronic
972967078 4:44523860-44523882 GCCCTTCTAGAAGCTGGGAAAGG + Intergenic
973627236 4:52785070-52785092 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
973852815 4:54977735-54977757 GCTCTTCAGTCAGCTTGTGATGG - Intergenic
974073014 4:57142362-57142384 ACCCTTCAGGACTTTGGTGAAGG - Intergenic
974953090 4:68604927-68604949 GCTGTTCAGGAAGCTGGGGCAGG - Intronic
975210253 4:71691420-71691442 GCACTTCAGGAGGCTGATGTGGG - Intergenic
976286171 4:83373370-83373392 ACCCTTCAGTAACCTGGTGCAGG + Intergenic
976582704 4:86757650-86757672 GCTATTCAGGAAGCTGGGGTGGG + Intronic
978872819 4:113600879-113600901 GCACTTCAGGAGGCCGGGGAAGG - Intronic
979547933 4:121957949-121957971 GCCCCTCAGGAAGCTGAGGTGGG + Intergenic
982251709 4:153413773-153413795 ACTCATCAGGAAGCTAGTGAGGG - Intronic
982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG + Intronic
982969067 4:161957570-161957592 CCCCTTCAGCAAGCTGTTGTGGG - Intronic
983498941 4:168477979-168478001 GCCCTTTGGGAAGCTGATGTGGG + Intronic
983531250 4:168811938-168811960 GACCTTCAGGAAACAGGCGAGGG - Intronic
983883933 4:172960956-172960978 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883965 4:172961073-172961095 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883999 4:172961190-172961212 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
984381290 4:178996458-178996480 GCACTTCAGGAAGCTGAGGTGGG + Intergenic
984853316 4:184172354-184172376 GCTCTTCAGGAGGCAGGTGTTGG - Intronic
985696647 5:1344800-1344822 GCCCACCACCAAGCTGGTGAAGG + Exonic
986108239 5:4682312-4682334 GCACTTCAGGAAGCTGACGTGGG + Intergenic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
987085266 5:14461981-14462003 TTCCTTCAGGATGCTGGAGATGG + Intronic
987163955 5:15174251-15174273 GCTCTTCAGTCAGCAGGTGATGG - Intergenic
987831633 5:23102933-23102955 GCTATTCAGGAAGCTGAGGAAGG + Intergenic
988339096 5:29946185-29946207 GCCCAAGAGCAAGCTGGTGATGG + Intergenic
988363361 5:30264797-30264819 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
988415200 5:30938260-30938282 GCACTTCAGGAAGCTGAGGCTGG + Intergenic
989751217 5:44895914-44895936 GCACTTTAGTCAGCTGGTGATGG + Intergenic
990221881 5:53600553-53600575 GCACTTCAGGAAGCTGAGGTGGG - Intronic
991715386 5:69446819-69446841 GCCCTTTAGGAGGCTGATGTGGG + Intergenic
992235086 5:74700952-74700974 GCACTTCGGGAAGCTGAGGAAGG - Intronic
992280371 5:75169091-75169113 GCACTTCATGAAGCTAGTGTAGG - Exonic
992483209 5:77171629-77171651 TCCCTTCAGGAAACAGGTGAGGG + Intergenic
995554716 5:113315619-113315641 GCACTTCAGGAAGCTGAAGGAGG + Intronic
997473218 5:134128285-134128307 GCCCTTCATGAGGCGAGTGAGGG - Intronic
997596004 5:135107864-135107886 GGCCTACTGGAAGCTGGTTAAGG + Intronic
997669765 5:135661171-135661193 GGCAGACAGGAAGCTGGTGAGGG - Intergenic
997782796 5:136676784-136676806 ACCCTTCAGGGATCTGGAGATGG - Intergenic
997996565 5:138591307-138591329 GCACTTCAGGAGGCTGAGGAGGG + Intergenic
998121105 5:139578697-139578719 GCACTTTAGGAAGCTGGGGCAGG - Intronic
998262183 5:140639798-140639820 GCCCCAGAGGAAGCTGGAGAGGG + Exonic
999174730 5:149624038-149624060 TGCCTTCAGGAAGCTGGTGGAGG + Exonic
999224328 5:150007943-150007965 GCCACTCAGGAAGCTGATGTGGG + Intronic
999254515 5:150202608-150202630 GCCAGCCAGGATGCTGGTGATGG - Exonic
999272385 5:150304151-150304173 GCCCTTCAAGAAGCTGGTTGGGG - Intronic
999366784 5:151028652-151028674 GCCCTTCAGGAAGTAGGAGTGGG - Exonic
999380888 5:151120468-151120490 GCACTTTAGGAAGCTGAAGAGGG + Intronic
999777437 5:154822408-154822430 GACCTTCAGGAAGGTGGTTGGGG + Intronic
999851545 5:155545533-155545555 ACATTACAGGAAGCTGGTGAAGG - Intergenic
1000926013 5:167194971-167194993 GCCCTTTAGGAAGTAAGTGATGG - Intergenic
1001870589 5:175151012-175151034 GCACTTCAGGAAGCTGAGGCAGG - Intergenic
1002144732 5:177170597-177170619 GCACTTCAGGAAGCTGAGGCAGG - Intronic
1003257995 6:4490634-4490656 GCCTTTCAGGCAGCAGGTGGGGG - Intergenic
1003456260 6:6285519-6285541 AGCCTTCAGGAAGCTGGGGCTGG - Intronic
1003912876 6:10758568-10758590 GCCCTTCTGGAGTCTGGTGGAGG + Intronic
1004211863 6:13655356-13655378 GCTATTCAGGAGGCTGGGGAAGG + Intronic
1004371208 6:15053915-15053937 GCTATTCAGGAAGCTGGGGTGGG + Intergenic
1004763647 6:18699494-18699516 AACTTTCAGGAAGCTGTTGATGG + Intergenic
1004986361 6:21087439-21087461 GCACTTCAGGAAGCTGAGGCTGG - Intronic
1005321158 6:24655719-24655741 TACCTTCTGGAAGCAGGTGAGGG - Intronic
1005568350 6:27119813-27119835 ACCCTTAAGCAAGCTGGTGGAGG - Intergenic
1005598222 6:27399504-27399526 GATCTTCAGGAAGCTGAAGAGGG + Exonic
1005823400 6:29616437-29616459 GCACTTCAGGAGGCTGAGGAGGG + Intronic
1006155158 6:32009781-32009803 GCCGTTGAGGAAGATGGTGCTGG + Intergenic
1006161464 6:32042515-32042537 GCCGTTGAGGAAGATGGTGCTGG + Exonic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1006637914 6:35473814-35473836 GACCTTCAGGAAGCTCGGGCAGG + Exonic
1007661624 6:43490235-43490257 GCCCAGCAGCAGGCTGGTGATGG - Intronic
1007668287 6:43529812-43529834 GCTCTTCAGGAAGCTGAGGTGGG + Intronic
1007904816 6:45448852-45448874 GCCCTTCAAGGAGATGATGAAGG + Intronic
1008155471 6:48008773-48008795 GTCCTTCATGGAGCTGGAGAGGG + Exonic
1012283728 6:97362882-97362904 GCCATTCAGGAGGCTGAGGAGGG - Intergenic
1012818755 6:104058174-104058196 GCACTTCAGGAAGCTGAGGTGGG + Intergenic
1013734195 6:113206596-113206618 GCCCTTCTGGGTGCAGGTGAAGG - Intergenic
1015306431 6:131713888-131713910 GCTCTTCAGGAAGCTGAGGCAGG - Intronic
1016675194 6:146756971-146756993 GCCCTTGGGGAAGCTGATGCAGG - Intronic
1017728857 6:157296569-157296591 GCTACTCAGGAAGCTGGGGAAGG + Intronic
1018614758 6:165676537-165676559 GCCCAGCTGGAAGGTGGTGAGGG + Intronic
1018694633 6:166382392-166382414 CCCCTTCAGGGAGTGGGTGACGG - Intronic
1018774676 6:167001845-167001867 GGACTTCAGGGAGATGGTGAGGG - Intronic
1018900237 6:168048205-168048227 GCACCTCAGCAAGCCGGTGAGGG - Intergenic
1019378874 7:711328-711350 GCACTTCGAGAAGCTGGAGAAGG - Exonic
1019479291 7:1259174-1259196 GCACTTCGGGAAGCTGAGGAGGG - Intergenic
1019540784 7:1550116-1550138 GCGCTTCTGTAAGCAGGTGAGGG - Exonic
1019726081 7:2603392-2603414 GCCCTCCAGTGAGCGGGTGAGGG + Intronic
1019789847 7:3004108-3004130 AACCAGCAGGAAGCTGGTGATGG - Intronic
1020225913 7:6279864-6279886 GAACTTCAGGAAGCTGGTATGGG - Intergenic
1020528261 7:9293416-9293438 GCTATTCAGGACGCTGGAGATGG - Intergenic
1021712305 7:23427759-23427781 GCACTTCAGGAGGCTGAGGAGGG + Intronic
1021904406 7:25319080-25319102 CCCCTGCAGGAAGCTGGCCAAGG + Intergenic
1023166018 7:37344276-37344298 GCACTTCAGGAGGCCGGGGAGGG - Intronic
1023833316 7:44052922-44052944 TACCTTCAGGAAGCTGGCCATGG - Exonic
1024747710 7:52427453-52427475 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1025930024 7:65986152-65986174 GCTATTCAGGAAGCTGAGGAAGG - Intergenic
1026350726 7:69512980-69513002 GCACTTTAGGAAGCTGAGGAGGG + Intergenic
1028463525 7:91122980-91123002 GCCCTTCAGAAACTTGGAGAAGG + Intronic
1029203148 7:98852504-98852526 GCACTTCAGGAGGCTGGGGCAGG - Intronic
1029616524 7:101661933-101661955 GCACTTCAGGAAGCTGAGGTGGG - Intergenic
1030229891 7:107196754-107196776 GCCATTCAGGAAGCTGAGGTGGG - Intronic
1032966841 7:137107488-137107510 CCCCATCAAGAAGTTGGTGAAGG + Intergenic
1032972012 7:137175189-137175211 GCTCTTCAGTTAGCAGGTGATGG - Intergenic
1033731118 7:144180612-144180634 GCTCTTCAGGAAGCTGAGGCAGG + Intergenic
1033740544 7:144272120-144272142 GCTCTTCAGGAAGCTGAGGCAGG - Intergenic
1033941251 7:146657430-146657452 TCCCTTCAGGTACCTGGTGGAGG + Intronic
1034367266 7:150561805-150561827 GCCCTTAATGGAGCTGTTGATGG - Intergenic
1034437965 7:151072115-151072137 GACCTTCTACAAGCTGGTGAAGG + Exonic
1034496587 7:151427054-151427076 TCCCTTCATGGGGCTGGTGATGG - Intergenic
1035521742 8:280234-280256 GCCCCTCTGGAAGCTGGAAAAGG - Intergenic
1035749577 8:1986924-1986946 GCTCTTCAGGAGGCTGATGCAGG + Intronic
1035792169 8:2317099-2317121 ACCCTGCAGGCAGATGGTGAGGG - Intergenic
1035800636 8:2404606-2404628 ACCCTGCAGGCAGATGGTGAGGG + Intergenic
1036650175 8:10637045-10637067 GCCTTGCAGTAGGCTGGTGAGGG + Intronic
1036938150 8:13025270-13025292 GCACTTCAGGAAGCTGAGGTGGG + Exonic
1036944983 8:13086775-13086797 GCACTTTGGGAAGCTGGGGAGGG + Intronic
1037036556 8:14176644-14176666 GCCCTTGAGTAACCTGGTGGGGG - Intronic
1037703823 8:21298287-21298309 CACCTTCAGGAAGCAAGTGATGG + Intergenic
1040670066 8:49679207-49679229 CCCCTTCAAAAAGCGGGTGAAGG + Intergenic
1041126155 8:54641189-54641211 GCACTTCAGGAGGCTGAGGAGGG - Intergenic
1042437087 8:68779063-68779085 GCTCTTCAGGAAGCTGAGGCAGG + Intronic
1042593399 8:70420594-70420616 TCCCTTCAGGAGGCTGGGGGTGG + Intergenic
1044236450 8:89836451-89836473 GCCCTTCAGGAGGCTGAGGTGGG - Intergenic
1044527954 8:93273503-93273525 CTCCAACAGGAAGCTGGTGATGG - Intergenic
1045885462 8:107091978-107092000 GACCTTCATGAAGCTTGTAATGG - Intergenic
1046099491 8:109598160-109598182 GCCATTCAGGAAGCTGCTGGGGG - Intronic
1047158099 8:122344814-122344836 GCTCCTCAGGGAGCTGGTAATGG + Intergenic
1048045443 8:130768340-130768362 GCCCTTAAGGAGTGTGGTGAGGG + Intergenic
1048159036 8:131994385-131994407 GCTCTTCAGGTAGCTGGAGAGGG + Intronic
1048173813 8:132133598-132133620 GCCCTTCAGGAGGCTGAGGCGGG - Intronic
1049103203 8:140594147-140594169 CCCATTCAGGGAGATGGTGATGG - Intronic
1049203447 8:141352596-141352618 GGCCTCCAGGAAGCTGGGGCAGG + Intergenic
1049705446 8:144040104-144040126 ACTGGTCAGGAAGCTGGTGAGGG - Exonic
1050243003 9:3658305-3658327 TCCCTTCAGGAACCTGAAGATGG - Intergenic
1051243969 9:15090532-15090554 GCTCTCCAGGAAGCAGGAGAAGG + Intergenic
1052014709 9:23451306-23451328 GCACTTTGGGAAGCTGGGGAAGG + Intergenic
1054750948 9:68905501-68905523 GAACTTCTGGAAGCTAGTGAGGG + Intronic
1056469803 9:86894357-86894379 GCGCATCTGGAAGCTGGTGAGGG - Intergenic
1057265089 9:93611759-93611781 GCACTTCAGGAAGCTGAGGCTGG - Intronic
1057786963 9:98094925-98094947 GCCCTTAAAGAAGCTCTTGACGG + Exonic
1057846646 9:98531191-98531213 GCCCTTCAGGAGCCTGGCGTTGG + Intronic
1058634498 9:107023357-107023379 ACCTCTCAGGGAGCTGGTGAGGG + Intergenic
1058829766 9:108805841-108805863 TCTCTTCAGGAAGCTGATAATGG - Intergenic
1059150890 9:111948751-111948773 GCACTTCAGGAAGCTGAGGCAGG + Intergenic
1059394565 9:114026263-114026285 GCCTGTGAGGAAGCTGGAGAGGG + Intronic
1060507525 9:124209323-124209345 GCACTTCAGGAAGCTGAGGTGGG - Intergenic
1061023139 9:128029748-128029770 GCACTTCAGGAAGCTGAGGCCGG - Intergenic
1061592067 9:131604022-131604044 GCCAGTGAGGAAGCTGGTGAGGG - Intronic
1061629604 9:131863773-131863795 AGCCTTCAGAGAGCTGGTGAGGG - Intronic
1061791777 9:133062979-133063001 GCCCCACAGGAAGCCGGTGTCGG + Intronic
1061795452 9:133083545-133083567 GCCCCACAGGAAGCCGGTGTCGG + Intronic
1062273614 9:135720724-135720746 GCCCTTCAGGGAGCTGGGGCTGG - Intronic
1062489595 9:136798906-136798928 GCCCTTCAGACAGCTGCTGCTGG + Intronic
1189629470 X:42936632-42936654 GCCCCTCAGGAAGCTGAGGCAGG + Intergenic
1190662036 X:52663694-52663716 GCCACTCAGGAGGCTGGTGCAGG + Intronic
1192304462 X:69944370-69944392 GCTCTTCAGTCAGCAGGTGATGG + Intronic
1193075656 X:77352830-77352852 CCCCTTCAAAAAGTTGGTGAAGG + Intergenic
1194326111 X:92519001-92519023 GCCCTTTGGGAGGCTGATGAAGG - Intronic
1195090141 X:101450762-101450784 GCTCTTCAGTCAGCAGGTGATGG + Intronic
1197717800 X:129722038-129722060 CCCCTTCAGGATGCTGGGGCTGG - Intergenic
1198871623 X:141181522-141181544 GCACTTTAGTAAGCTGGAGAGGG - Intergenic
1199438928 X:147846117-147846139 GCTCCTCAGGAAGCTGATGTGGG - Intergenic
1200940745 Y:8777923-8777945 GCCCTTCAGGAAACTGAGTAGGG - Intergenic