ID: 1006636861

View in Genome Browser
Species Human (GRCh38)
Location 6:35467486-35467508
Sequence CTGGTGAGGGGAAGGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006636844_1006636861 24 Left 1006636844 6:35467439-35467461 CCGCACCCCCTCCACTTCCCTGC No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636851_1006636861 7 Left 1006636851 6:35467456-35467478 CCCTGCTCAATGACAAGGAACAT No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636847_1006636861 17 Left 1006636847 6:35467446-35467468 CCCTCCACTTCCCTGCTCAATGA No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636846_1006636861 18 Left 1006636846 6:35467445-35467467 CCCCTCCACTTCCCTGCTCAATG No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636845_1006636861 19 Left 1006636845 6:35467444-35467466 CCCCCTCCACTTCCCTGCTCAAT No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636842_1006636861 29 Left 1006636842 6:35467434-35467456 CCCATCCGCACCCCCTCCACTTC No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636848_1006636861 16 Left 1006636848 6:35467447-35467469 CCTCCACTTCCCTGCTCAATGAC No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636849_1006636861 13 Left 1006636849 6:35467450-35467472 CCACTTCCCTGCTCAATGACAAG No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636852_1006636861 6 Left 1006636852 6:35467457-35467479 CCTGCTCAATGACAAGGAACATC No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data
1006636843_1006636861 28 Left 1006636843 6:35467435-35467457 CCATCCGCACCCCCTCCACTTCC No data
Right 1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006636861 Original CRISPR CTGGTGAGGGGAAGGGTGTA GGG Intergenic
No off target data available for this crispr