ID: 1006638555

View in Genome Browser
Species Human (GRCh38)
Location 6:35476796-35476818
Sequence GTGTGCTTGTAGCTGTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006638551_1006638555 12 Left 1006638551 6:35476761-35476783 CCATAGAGATGTGTGTAAATGTA 0: 1
1: 0
2: 4
3: 41
4: 673
Right 1006638555 6:35476796-35476818 GTGTGCTTGTAGCTGTGTATTGG 0: 1
1: 0
2: 1
3: 15
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006638555 Original CRISPR GTGTGCTTGTAGCTGTGTAT TGG Intronic
900416287 1:2536310-2536332 GTGTGCGTGTGTCTGTGTGTGGG - Intergenic
900593567 1:3470366-3470388 GTGTGTGTGTAGGTGTGCATGGG + Intronic
900953023 1:5869006-5869028 GTGTGCATGTGTGTGTGTATGGG - Intronic
901518559 1:9765907-9765929 TTGTGCTTGCAGCAGTGAATTGG - Intronic
904041772 1:27589598-27589620 GTGTGCTTGTGTTTCTGTATGGG + Intronic
904041778 1:27589694-27589716 GTGTGTCTGTATCTGTGTGTTGG + Intronic
905174357 1:36126494-36126516 GTGTGCATGTAGGTGAGTGTGGG + Intergenic
905174362 1:36126524-36126546 GTGTGCATGTAGGTGGGTGTGGG + Intergenic
905174452 1:36127021-36127043 GTGTGTGTGTGGCTGTGTGTGGG + Intergenic
906693378 1:47807909-47807931 GTATGGTTGAAGATGTGTATGGG + Intronic
908542103 1:65131323-65131345 TGGTGCTGGGAGCTGTGTATTGG + Intergenic
909807171 1:79885663-79885685 GTGTGTTTGTGGGTGAGTATTGG - Intergenic
909927377 1:81453988-81454010 TTGTTATTGGAGCTGTGTATTGG - Intronic
910593750 1:88955849-88955871 GTGTGTGTGTATGTGTGTATGGG + Intronic
915670816 1:157487130-157487152 GTGTGCTTATATCTGTTTAAAGG + Intergenic
916058804 1:161085309-161085331 CTGTGCTGGGAGCTGTGTCTGGG - Intronic
916519137 1:165547561-165547583 TTGTGATTGTATGTGTGTATGGG - Intronic
916714306 1:167436338-167436360 GTGTGGTGTTAGCTGTGGATTGG - Intronic
918391661 1:184070244-184070266 GTGTGTTTGTATGTGTGTGTTGG - Intronic
918866823 1:189911300-189911322 GTGTGCATGTAGCTGTTTAAGGG - Intergenic
920191243 1:204195220-204195242 GTATGCGTGTATATGTGTATGGG - Intronic
920825283 1:209419241-209419263 GTGTGCTTGAATCTGGGCATGGG - Intergenic
921719202 1:218451653-218451675 GTGGGCTTGAAGCTTTCTATGGG + Intergenic
924025116 1:239824012-239824034 GTGTGCCTGTGGCTGTGACTCGG + Intronic
924745180 1:246826012-246826034 GTGTGTGTATAGGTGTGTATAGG + Intergenic
1062886485 10:1020569-1020591 CTGTGAATGTAGCTGTGGATGGG - Intronic
1063254246 10:4308749-4308771 GTCTGCTTGTAGATGTGAACTGG - Intergenic
1063274966 10:4556025-4556047 GTGTGCCTGGGGCTGGGTATTGG + Intergenic
1063539067 10:6913824-6913846 GTGTGCATGTGTCTGTGTATTGG - Intergenic
1063929633 10:11016793-11016815 GTGTGCGTGTATGTTTGTATAGG + Intronic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064341546 10:14490050-14490072 GTGTACTTCTTACTGTGTATAGG - Intergenic
1066055509 10:31677112-31677134 GTGTGCATGCATGTGTGTATTGG - Intergenic
1069984738 10:72275357-72275379 GTGTGCGGGTGGCTGTGCATTGG + Exonic
1070153962 10:73822067-73822089 GTCAGGTTGTAGCTGTGCATTGG - Intronic
1070802870 10:79253859-79253881 GTGTGCATGTACCTGTGTGTGGG - Intronic
1072238153 10:93470791-93470813 GTGTGCTTAGCTCTGTGTATAGG - Intronic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1072880221 10:99219415-99219437 GTGTGCTTGTAGGTGTGCAAGGG - Intronic
1072882120 10:99237731-99237753 GTGTGTGTGTGTCTGTGTATGGG + Intergenic
1073902693 10:108242234-108242256 GTGTGTTTGTAATTCTGTATGGG + Intergenic
1074372707 10:112913279-112913301 GTGTGTGTGTAGGTGTGTGTGGG + Intergenic
1075816197 10:125266459-125266481 GTGTGCATGTGTGTGTGTATAGG + Intergenic
1077642537 11:3894641-3894663 GGGTCCTGGTAGCTGTGTTTAGG + Intronic
1078088940 11:8251877-8251899 GTGTGTGTATAGGTGTGTATGGG + Intronic
1080846376 11:36030636-36030658 GTGTGTCTGTACCTATGTATGGG + Intronic
1083510893 11:63208740-63208762 GTGTGCTTGGAGGTGAGTGTGGG + Intronic
1084545891 11:69814954-69814976 GTGTCCTGGAAGCTGTGTCTGGG - Intronic
1084604542 11:70164913-70164935 CTGTGCTTGGGGCTGTGGATGGG - Intronic
1088183034 11:107133662-107133684 GAGTGTCTGTGGCTGTGTATCGG + Intergenic
1089311828 11:117563157-117563179 GGGTGCTTGTAGCTGACTCTGGG + Intronic
1091230959 11:133987779-133987801 GTGTGTATATAGATGTGTATGGG + Intergenic
1091775439 12:3181975-3181997 GTGTGCTTGTGTTTGTGTGTTGG + Intronic
1091879675 12:3967051-3967073 GTGTGCACGTACCTGTGTATGGG + Intergenic
1092620958 12:10267928-10267950 GTGTGCTTTTAGCTGGGGAAGGG + Intergenic
1092692020 12:11123057-11123079 GTCTGCTTTGAACTGTGTATAGG + Intronic
1092870128 12:12798830-12798852 GTGTGTCTGTGGGTGTGTATTGG - Intronic
1093273474 12:17095363-17095385 GTGTGCATGTGGATGTGTATTGG + Intergenic
1093400189 12:18736866-18736888 GTGTGTGTGTAGCTGGGCATTGG - Intronic
1094086182 12:26594541-26594563 GAGTGCTAGTAGCTTTGTATAGG - Intronic
1095048148 12:37533116-37533138 GTGTGTTTGTGTCTGTGTGTGGG + Intergenic
1099308344 12:80986286-80986308 GTGTGTTTGTAGCTGCCTCTAGG + Intronic
1100164359 12:91899979-91900001 GTGTGCGTGTGCCTGTGGATGGG - Intergenic
1101090745 12:101282438-101282460 GTGTGGTTATAGGTGTGTATAGG + Intronic
1101313009 12:103600812-103600834 GTCTGCCTGTAGCTGTGCAAAGG - Intronic
1104624759 12:130342180-130342202 GTGTGTGTGTGTCTGTGTATGGG + Intronic
1104793234 12:131497380-131497402 GTGTGCTTGGGGATGTGGATGGG - Intergenic
1104805077 12:131584649-131584671 GTGTCCTTGTAGGTGTTTTTAGG - Intergenic
1105777794 13:23679249-23679271 GTGTTCTGGTAGCTTTGTTTGGG + Intergenic
1105965310 13:25378208-25378230 GTGTGCTTGTTTATGTGAATAGG + Intronic
1107022027 13:35761737-35761759 GGGTGTGTGTAGGTGTGTATTGG - Intergenic
1107977834 13:45706703-45706725 GTGTTCTTGGGGCTTTGTATTGG + Intronic
1109622016 13:64923070-64923092 GTGTGCGTGTGTGTGTGTATAGG + Intergenic
1110444797 13:75567357-75567379 GTGGGATTGTAGATGTGTTTGGG + Intronic
1111617372 13:90677704-90677726 GTGTGCATGTGTGTGTGTATGGG + Intergenic
1112263070 13:97895714-97895736 GTGTCCTGGTAGATGTGTAATGG - Intergenic
1113913862 13:113859750-113859772 GTGTGCATGTGTCTGTGTGTGGG + Intronic
1114038055 14:18648055-18648077 GTGTGCTGGAAGCTGTGTTCAGG - Intergenic
1118188568 14:63559708-63559730 GTGTGTTTGTGTATGTGTATGGG + Intergenic
1119554971 14:75546274-75546296 ATATGTTTGTAGGTGTGTATGGG - Intronic
1120263533 14:82219287-82219309 GTTTGGCTGTTGCTGTGTATGGG - Intergenic
1121255060 14:92525117-92525139 GTGTCATGGTAGGTGTGTATGGG + Intronic
1122630453 14:103105192-103105214 GTGTGTTTGTGTCTGTGTGTTGG + Intronic
1124591753 15:31060106-31060128 GTGTGTCTGTATGTGTGTATAGG - Intronic
1124636187 15:31366387-31366409 GTGTGCCTGTGCCTGTGCATGGG - Intronic
1124646987 15:31444267-31444289 GTGTGTGTGTAGGTGTGTGTCGG + Intergenic
1125622178 15:41073278-41073300 GTGTGTGAGTAGCTGTGTGTAGG - Intronic
1126096218 15:45092642-45092664 GTGTTCTTGTACCTATGTTTTGG - Exonic
1126506540 15:49410986-49411008 GTGTGTGTGTATCTGTGTGTGGG + Intronic
1128656343 15:69464821-69464843 GTTTTCATGTAGCTATGTATAGG + Intergenic
1128713929 15:69893265-69893287 GTGGGCTTGTATTTGTGTTTGGG - Intergenic
1128916538 15:71567789-71567811 GTGTGTTTGTAGGTGTGTGTGGG + Intronic
1129178080 15:73854397-73854419 GTGTGGGTGTAGCTGTGTGCTGG - Intergenic
1129201399 15:74003457-74003479 GTGTGCATGTATGTGTGTGTTGG - Intronic
1131686225 15:94770890-94770912 GTGTATGTGTATCTGTGTATGGG - Intergenic
1132998560 16:2837323-2837345 GTGTGCGTGTCTCTGTGGATGGG - Intronic
1133993510 16:10729197-10729219 GTGTGTGTGTGGCTGAGTATGGG + Intergenic
1134115415 16:11544174-11544196 GTGTGTTGGGGGCTGTGTATGGG - Intergenic
1134316285 16:13121820-13121842 GTGTGTGTGTATGTGTGTATAGG - Intronic
1135904486 16:26498753-26498775 GTGCAGTTGTTGCTGTGTATGGG - Intergenic
1138196522 16:55056509-55056531 GTGTGCTTTCACATGTGTATGGG - Intergenic
1141649049 16:85383354-85383376 GTGTGTATGCAGCTGTCTATTGG - Intergenic
1142226994 16:88882314-88882336 GTGTGGGTGTAGCTGTGTGTGGG + Intronic
1142289882 16:89188867-89188889 GTGTGCTGGCATCTGTGTGTGGG - Intronic
1143315492 17:6029004-6029026 GTGTGCTTGTACCTCTGGGTAGG - Intronic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1146356648 17:32140037-32140059 GTGGGGTTGTAGATGTGTACTGG - Intergenic
1146457567 17:33019355-33019377 GTGTGCTTGTGTGTGTATATGGG + Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1147141416 17:38462775-38462797 CTGTGTGTGTAGCTGTGCATGGG + Intronic
1147663687 17:42131377-42131399 GTGTGTTTGTGTGTGTGTATCGG - Intronic
1147868297 17:43568899-43568921 GTGTGTGTGTACCTGTGCATGGG + Intronic
1148710598 17:49678017-49678039 GTGTGTGTGTATTTGTGTATCGG - Exonic
1150291521 17:63985079-63985101 TTGTGCTGGGAGCTGTGTGTGGG + Intergenic
1152695686 17:81793040-81793062 GTGTGTTTGTGGGTGTGTGTGGG - Intergenic
1152914871 17:83028910-83028932 GTGTATTGGTGGCTGTGTATTGG - Intronic
1155594960 18:27475006-27475028 GTGTGCATGTATCTTTGTAATGG - Intergenic
1155851223 18:30776841-30776863 GTGTGCGTGTGTGTGTGTATTGG + Intergenic
1156042403 18:32837177-32837199 TTGTGCTTCTAGCTCTGTCTTGG + Intergenic
1157300035 18:46472667-46472689 GTGGGCTTCTAGCTCTGTCTTGG + Intergenic
1157466955 18:47955617-47955639 GTGTGCTTATTGCTCTGTGTTGG - Intergenic
1159708283 18:71719910-71719932 GTGTGCTTGGCGCTGTGCTTTGG - Intergenic
1159847335 18:73478580-73478602 GTGTGTTTGTGGGTATGTATAGG + Intergenic
1160572601 18:79828729-79828751 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572603 18:79828784-79828806 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572606 18:79828842-79828864 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572612 18:79829009-79829031 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572614 18:79829064-79829086 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572617 18:79829122-79829144 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572620 18:79829180-79829202 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1164849052 19:31465406-31465428 GTGTATTTGTATGTGTGTATTGG + Intergenic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
926054407 2:9766060-9766082 GTGTGCATGTGGGTGTGTAGAGG - Intergenic
926123509 2:10257395-10257417 GTGTGTTTGTGTGTGTGTATGGG - Intergenic
926228309 2:10983885-10983907 GTGGGCTGGTGGCTGTGTCTAGG + Intergenic
926790336 2:16564676-16564698 GTGTGTGTGTATGTGTGTATTGG + Intronic
927267486 2:21168151-21168173 GTTTTCTTGAATCTGTGTATTGG + Intergenic
929674325 2:43909976-43909998 GTGTGTATGTATCTGTGGATTGG - Intronic
929795786 2:45057395-45057417 GTGTGTGTGTACCTGTGTGTGGG + Intergenic
930459177 2:51648914-51648936 GTGTGCTTTGATCTGTGTGTTGG - Intergenic
936380883 2:111984925-111984947 GTGTGCTTGGAACTGGGTAGGGG + Intronic
936621630 2:114105277-114105299 GTGTGTATGTGTCTGTGTATGGG + Intergenic
937011607 2:118567820-118567842 GTATGTTTGTAGCTGAGTTTGGG - Intergenic
937085052 2:119166034-119166056 GTGAGCTTGTTGCAGTGTCTGGG + Intergenic
937337972 2:121073598-121073620 GTGTGTTTGTGTCTGTGTGTTGG - Intergenic
938277681 2:130041034-130041056 GTGTGCTGGAAGCTGTGTTCAGG + Intergenic
938328642 2:130431837-130431859 GTGTGCTGGAAGCTGTGTTCAGG + Intergenic
938361303 2:130689657-130689679 GTGTGCTGGAAGCTGTGTTCAGG - Intergenic
938437706 2:131296347-131296369 GTGTGCTGGAAGCTGTGTTCAGG - Intronic
938443331 2:131355075-131355097 GTGTGCTGGAAGCTGTGTTCAGG - Intergenic
941095773 2:161238403-161238425 GTGTGCATTTATCTGTATATGGG - Intergenic
947077385 2:226360099-226360121 GTGTGTGTGTATGTGTGTATTGG - Intergenic
947211106 2:227709593-227709615 GTGTGCAAGTGGGTGTGTATGGG - Intronic
947750397 2:232529082-232529104 GTGTGTGAGGAGCTGTGTATTGG - Intronic
948046112 2:234946600-234946622 GTGTGCTAGGAGCTGAGGATAGG - Intergenic
948997421 2:241589833-241589855 GTCTGCTTGTTGCTGTGTGGTGG - Intronic
1169186045 20:3618072-3618094 CTGATCTTGTAGCTGTGTGTGGG + Intronic
1171275924 20:23856359-23856381 GTGTGCATGTGGCTGTGTGGGGG - Intergenic
1172502792 20:35438895-35438917 GTGTGCCTGTGTGTGTGTATTGG + Intronic
1172876013 20:38164861-38164883 GTGTGCCTGGAGCTGTGCAGGGG - Intronic
1173923954 20:46766878-46766900 GTATGATTGGAGCTGCGTATAGG - Intergenic
1174225493 20:48995861-48995883 GTGTGGTTGTAGCTGTGGACAGG + Exonic
1175568330 20:59998601-59998623 ATGTGCCTTTAGCTGTGAATGGG - Intronic
1177499253 21:21930863-21930885 GTGTGTGTGTATCTGTGCATGGG + Intergenic
1180051340 21:45332439-45332461 GTGTGTCTGTATCTGTGTGTCGG + Intergenic
1180051342 21:45332589-45332611 GTGTGTCTGTATCTGTGTGTTGG + Intergenic
1180059711 21:45378609-45378631 GTGCCCTTGTCCCTGTGTATTGG - Intergenic
1180462182 22:15575096-15575118 GTGTGCTGGAAGCTGTGTTCAGG - Intergenic
1181656099 22:24300443-24300465 GTGTGCTTGTATCTTTATAGTGG + Intronic
1182084810 22:27554314-27554336 GTGTGCTTGTCTCTCTGTCTAGG - Intergenic
1182822345 22:33227762-33227784 GTGTGCTTGGAGCTATGTATGGG + Intronic
1184491724 22:44813734-44813756 GTGTGTATGTAGGTGTGTGTAGG - Intronic
1185203785 22:49524897-49524919 GTGTGCATGTGGGTGTGTACGGG - Intronic
949709266 3:6855756-6855778 GTGTGCCTGTATCTGAGTTTGGG + Intronic
949776580 3:7639303-7639325 GTGTGCTTGCGGCTGCGCATGGG - Intronic
955711660 3:61785858-61785880 GTGTGTATGTGTCTGTGTATTGG - Intronic
956421030 3:69086295-69086317 GTGTGCTTGGAGCTTGGCATGGG - Intronic
956449310 3:69357503-69357525 GTGAGCTTGTACATATGTATTGG + Intronic
956841489 3:73144093-73144115 GTGTGCTTGTGTCTGATTATGGG + Intergenic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
957046627 3:75379942-75379964 GTGTGCTTGCATGTGTGTGTAGG - Intergenic
957493387 3:80959004-80959026 GTTTGTTTGTAGTTTTGTATCGG + Intergenic
957982807 3:87532509-87532531 GTGTGGTTGTGTATGTGTATGGG - Intergenic
959951233 3:112183268-112183290 GTATGCTGGTGGTTGTGTATTGG + Intronic
960949239 3:122988368-122988390 GTTTGATTTTAGCTGGGTATGGG - Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962608739 3:137055103-137055125 TTGTTCTTGTAGCTGAGGATTGG + Intergenic
963016607 3:140829741-140829763 GTGTTCTTGTATGTGTGTGTGGG - Intergenic
965419097 3:168434914-168434936 GTGTGCTTGTTGCTGTTGTTTGG - Intergenic
966318082 3:178671111-178671133 GTGTGTTTGTACGTGTGTTTTGG - Intronic
966321940 3:178710646-178710668 GTGTGCGTGTCTCTGTGTATAGG + Intronic
966933848 3:184692774-184692796 GTGTGTGTGTGTCTGTGTATTGG + Intergenic
967462938 3:189767321-189767343 ATGTTCTTGTTGTTGTGTATAGG + Intronic
968523116 4:1043321-1043343 GTGTGCGTGTAGGTGTATGTAGG - Intergenic
968935746 4:3609382-3609404 GTGTGCATGTGTCTGTGTGTTGG - Intergenic
968990919 4:3911053-3911075 GTGTGCTTGCATGTGTGTGTGGG - Intergenic
969893035 4:10277231-10277253 TTGTGCTTGTCCCTGTGTTTAGG + Intergenic
970629639 4:17926125-17926147 GTGTGATTTCAGATGTGTATGGG + Intronic
971495139 4:27256231-27256253 GTGTGCATGTAGAAGGGTATAGG - Intergenic
972838342 4:42902592-42902614 GTGTGCATGTATCTTTGTAATGG + Intronic
973052913 4:45616659-45616681 GTGTGCATGTATGTGTGTGTGGG + Intergenic
976281610 4:83332386-83332408 GTGTGCTTGTCGATGCGTCTGGG + Intronic
978038093 4:104021601-104021623 GTGAGCTTGTGTCTATGTATGGG - Intergenic
979092344 4:116501084-116501106 GTGTGATTTTAAGTGTGTATGGG - Intergenic
981782040 4:148442016-148442038 GTGTGCTTGTTGTTTTGTTTTGG - Intronic
982173465 4:152683431-152683453 GTGTGCCTGTGGGTGTGTGTTGG - Intergenic
985080262 4:186257916-186257938 GTGTGTGTGTTGCTGTGTAGTGG + Intronic
985606516 5:861065-861087 GTGTGTGTGCAGGTGTGTATGGG - Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
986205422 5:5620539-5620561 GTGTGCCTGTTTCTGTGTCTTGG - Intergenic
987542044 5:19268780-19268802 GTGTGTATGTATCTGTGTGTGGG - Intergenic
988298831 5:29395981-29396003 GACTGCTTGTAGCTGTGGAAGGG - Intergenic
989818405 5:45764723-45764745 CTGTGTTTGCAGTTGTGTATCGG + Intergenic
993834305 5:92797868-92797890 GTGTGTTTATAGCTGCCTATTGG + Intergenic
995259769 5:110089653-110089675 GTGTGATTGTATGTGTGTCTAGG + Intergenic
996458158 5:123708875-123708897 GTGTGATTATAGCTGTGTTCTGG + Intergenic
998893065 5:146767523-146767545 GTGTGTATGTATGTGTGTATTGG - Intronic
999434202 5:151550536-151550558 GTTTGCATGTAGATGTGTAGGGG - Intronic
999918266 5:156287653-156287675 GTGTGTGTGTATGTGTGTATGGG + Intronic
1001245732 5:170104938-170104960 GTGTGCGTGTATGTGTGTGTTGG + Intergenic
1002345929 5:178547564-178547586 GTGTGGGTGTAGGTGTGTGTGGG - Intronic
1005282108 6:24285037-24285059 GTGTGCATGTATGTGTGTGTGGG - Intronic
1006638555 6:35476796-35476818 GTGTGCTTGTAGCTGTGTATTGG + Intronic
1006929989 6:37681741-37681763 GTGTGTGTGTATCTGTGTATAGG - Intronic
1007104653 6:39275205-39275227 GTGTGCTTTTAGCTGAGAAAAGG + Intergenic
1007324402 6:41049032-41049054 GTGTGTGTGTATCTGTGTTTTGG - Intronic
1009909293 6:69905381-69905403 CTGTCCATGTAGCTGTGTGTGGG - Intronic
1014032710 6:116724489-116724511 GTGTGTCTGTATCTGTGTCTTGG + Intronic
1016001262 6:139043800-139043822 GTGTGCTTATTGCTGAGTTTGGG + Intergenic
1016622857 6:146132797-146132819 GAATGATTGTAGCTGTGTACAGG - Intronic
1016653269 6:146487420-146487442 GTGTGTATGTATCTGTGTTTGGG + Intergenic
1017051379 6:150397140-150397162 GTGTGCATGTATCTATATATGGG + Intronic
1018165346 6:161088991-161089013 GTGTGCATGTGTGTGTGTATTGG - Intronic
1018709287 6:166486239-166486261 GTGTGCTCACAGCTGTGTGTGGG - Intronic
1019328900 7:453075-453097 GTGTGCTTCTGGCTGTGGCTTGG + Intergenic
1019553811 7:1618643-1618665 GTGTACATGTAGGTGTGCATAGG + Intergenic
1019553841 7:1618830-1618852 GTGTACATGTAGGTGTGCATAGG + Intergenic
1019934986 7:4248876-4248898 GTGTGCTTGTACTTGTATTTAGG - Intronic
1022045618 7:26620081-26620103 GGGTGTTTTTAGCTGTGCATTGG + Intergenic
1023192714 7:37599932-37599954 GTGTTCATGCAGCTGTGTTTAGG + Intergenic
1024473712 7:49789309-49789331 GTGTGGGTGTAGGTGTGTGTGGG + Intronic
1026401012 7:70012938-70012960 GTGTGCATGTATGTGTGTTTTGG + Intronic
1026437175 7:70409497-70409519 GTGGGCTTGTACATGTGTGTAGG + Intronic
1029278320 7:99420637-99420659 GTGTGGTAGTAGCTGTATGTTGG - Intronic
1029893652 7:103958587-103958609 GTGTGTGTGTAGGAGTGTATGGG + Intronic
1029949978 7:104573597-104573619 GTGTGAATGTAGCTGTGAACAGG - Intronic
1030183543 7:106736517-106736539 ATGTCCTTGTAGCTTTGCATTGG + Intergenic
1030263525 7:107591629-107591651 GTGTGTGTGTATGTGTGTATGGG - Intronic
1030279167 7:107752460-107752482 GTGTGTCTGTGTCTGTGTATAGG + Intronic
1032086755 7:128888010-128888032 GTGTGTGTGTGGCTGTGTGTGGG - Intronic
1034423176 7:150999696-150999718 GTGGGTTTGTGGGTGTGTATAGG + Intronic
1035336419 7:158130892-158130914 GTGTGTCGGTAGATGTGTATCGG - Intronic
1035877395 8:3206346-3206368 GTGTGTGTGTATGTGTGTATTGG + Intronic
1036212149 8:6851127-6851149 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1036212189 8:6851513-6851535 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1037464061 8:19141597-19141619 GTGTGCGTGTACGTGTGTGTGGG - Intergenic
1037602307 8:20407416-20407438 GTGTGTTTGTGTGTGTGTATAGG + Intergenic
1037701415 8:21277985-21278007 GTATGCTTGAAGCTGTCTCTTGG + Intergenic
1039842857 8:41306468-41306490 GTGTGTGTGTAGGTGTGTAGAGG - Intronic
1040757848 8:50802484-50802506 GTGTCCTTGTAGATGTCTTTAGG + Intergenic
1043232399 8:77819635-77819657 GTGTGTTTTTAGTTGTGCATAGG - Intergenic
1044776833 8:95698757-95698779 GTGTGCTTGTGTGTGTGTTTGGG - Intergenic
1045970467 8:108074385-108074407 GTGTTCATGTATGTGTGTATGGG - Intronic
1046223493 8:111246113-111246135 GTATGGCTGTAGCTTTGTATGGG + Intergenic
1048740769 8:137558236-137558258 GTGTGTTTCTATGTGTGTATGGG - Intergenic
1050191177 9:3028160-3028182 GTGTATATGTACCTGTGTATAGG - Intergenic
1050612125 9:7363770-7363792 CTGTGATTGTATCTGGGTATTGG - Intergenic
1052760967 9:32590685-32590707 GTGTGCTTTTATCTGTGTGTGGG + Intergenic
1052900191 9:33786967-33786989 CTGTGCTTGTAGGTGGGCATGGG + Intronic
1053234283 9:36438570-36438592 TTCTGCTTGTAAGTGTGTATTGG - Intronic
1054454437 9:65422496-65422518 GTGTGCATGTGTCTGTGTGTTGG + Intergenic
1056195698 9:84226410-84226432 GTGTGTGTGTGTCTGTGTATTGG + Intergenic
1059413299 9:114147721-114147743 GTGTGCGTGTGTGTGTGTATGGG - Intergenic
1059827362 9:118045900-118045922 GTGTGCATGTAAGTGTGTAGGGG + Intergenic
1062251928 9:135602426-135602448 GTGTGCGTGTATGTGTGTGTAGG - Intergenic
1062408020 9:136406923-136406945 GTGAGCTAGAAGCTGTGAATTGG - Intronic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1188576209 X:31653543-31653565 GTCTGCTTGTAGCTGTATGAGGG - Intronic
1190690795 X:52911466-52911488 TTGTCCCTGTACCTGTGTATGGG + Intergenic
1190695188 X:52944326-52944348 TTGTCCCTGTACCTGTGTATGGG - Intronic
1192185502 X:68944253-68944275 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1194167527 X:90537847-90537869 GGTTGCTAATAGCTGTGTATGGG + Intergenic
1199972737 X:152872758-152872780 GTGTGTTTGTGGGTGTGTGTGGG + Intergenic
1200513787 Y:4115626-4115648 GGTTGCTAGTAGCTGTGTATGGG + Intergenic
1201614168 Y:15877693-15877715 GTGTGTGTGTATGTGTGTATGGG - Intergenic
1201616200 Y:15902084-15902106 GTGTGTGTGTATGTGTGTATGGG + Intergenic