ID: 1006640257

View in Genome Browser
Species Human (GRCh38)
Location 6:35485975-35485997
Sequence GTGGGGAAGGGGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1604
Summary {0: 1, 1: 0, 2: 12, 3: 158, 4: 1433}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006640239_1006640257 29 Left 1006640239 6:35485923-35485945 CCCTTCTGGAAATGGGCAAGATG 0: 1
1: 0
2: 0
3: 25
4: 243
Right 1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 158
4: 1433
1006640240_1006640257 28 Left 1006640240 6:35485924-35485946 CCTTCTGGAAATGGGCAAGATGG 0: 1
1: 0
2: 2
3: 19
4: 188
Right 1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 158
4: 1433
1006640249_1006640257 -7 Left 1006640249 6:35485959-35485981 CCAACAAACCCAAGGAGTGGGGA 0: 1
1: 0
2: 0
3: 18
4: 301
Right 1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 158
4: 1433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006640257 Original CRISPR GTGGGGAAGGGGACTGAGGA GGG Intronic
900140149 1:1136437-1136459 GTGAGGGTGGGGACTGGGGACGG + Intergenic
900155944 1:1203339-1203361 GTGGGGGTGGGGCCCGAGGAGGG - Intergenic
900192188 1:1356338-1356360 GTGGGGAAGGGGACTCAGTAGGG + Intronic
900522294 1:3111515-3111537 GAGGGGAAGGGGAGAGCGGAGGG + Intronic
900611427 1:3546181-3546203 GTGGGGGAGGAGGCCGAGGAGGG - Intronic
900693508 1:3995831-3995853 GTATGGAAGGAGACTGAGGCTGG + Intergenic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901646245 1:10718260-10718282 GTGGGCACGGGGACACAGGAAGG - Intronic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902269982 1:15296794-15296816 GTGAGGGAGGGGTCTGGGGAAGG + Intronic
902477697 1:16696991-16697013 GTTGGGAAGGGGGCTGCAGAGGG - Intergenic
902515963 1:16989826-16989848 GTGAGGAAGGAGACAGAGCAGGG + Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902625179 1:17672194-17672216 GTGGGGAAGGCGGCTGGGGCGGG - Intronic
902709782 1:18230850-18230872 GGGAGGAAGGGGTCAGAGGAGGG - Intronic
902740889 1:18437167-18437189 GTGGAGGAGGGGGCTTAGGAGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
902778384 1:18689327-18689349 GTGGGGAAGGGGCCCCAGGATGG + Intronic
902816536 1:18919489-18919511 GTGGGGAGGGGGCGGGAGGAGGG + Intronic
902973510 1:20072136-20072158 ATGGGGACGGGGACTGTTGATGG - Intronic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903342329 1:22662216-22662238 GCGAGGAAGGGCACTGAGGTGGG - Intergenic
903543060 1:24107696-24107718 GTGGGGGAGGGGGCTAAGAATGG - Intronic
903684354 1:25120097-25120119 GTGAGGCAGGGGGCTCAGGAGGG - Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904710062 1:32423528-32423550 GTGGGGAAGGGGTATAAGGCTGG + Intergenic
904868303 1:33600141-33600163 GTGGGGAAGGGACCTGTGCAAGG + Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905030738 1:34882843-34882865 GTGGGGCAGGGGAGTGGGAAGGG - Intronic
905033338 1:34902150-34902172 GTGGGGGAGAGGACTGGGGGAGG + Intronic
905194047 1:36260343-36260365 GCTGGGAAGGGGAGTGGGGAAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905647034 1:39632259-39632281 GTGGGGGAGGGGACAGAAGAAGG - Intronic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
905968061 1:42116048-42116070 GTGGGGAGTGGGACTGGGGCAGG + Intergenic
906082997 1:43106734-43106756 GTGTGGAAGGGGACTGGAGCTGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906843577 1:49165775-49165797 GGAGGGAAGGGGATGGAGGAAGG + Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907276683 1:53320726-53320748 CTGGGGAGTGGGACTGGGGAGGG - Intronic
907455425 1:54572422-54572444 GTAGGGCAGGGGTCTGAGGAGGG + Intronic
907464070 1:54623578-54623600 GTGGGGAAGAGGATTGGGGCGGG - Intronic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908470307 1:64437576-64437598 GGGGGGAAGGGGACTAGGCAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908671044 1:66548009-66548031 GTGAGGAAGGGAACAGAGGCAGG + Intronic
908843052 1:68297830-68297852 CAGGGGAAGGGGGCTGAGGTGGG - Intergenic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909433512 1:75615883-75615905 GGAGGGAAGGGGACAGAAGATGG - Intergenic
909473368 1:76054621-76054643 GTGGGGAAATTGACTGGGGAAGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
911372138 1:97006353-97006375 CTGGGGAATGGGACTCAGAATGG + Intergenic
912494668 1:110083911-110083933 GTGGGTGCGGGGACTGCGGAGGG + Intergenic
913287649 1:117241424-117241446 GGGGGGAAGGGGAGTGGGGGTGG - Intergenic
913349334 1:117840980-117841002 GTGGGAAAGGGAATTGATGAGGG - Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
914205201 1:145520743-145520765 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
914207805 1:145549493-145549515 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
914391561 1:147228151-147228173 GTGGGGTGGGGGGCTGGGGAAGG - Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
915165495 1:153945957-153945979 GAGGGGGAGGAGGCTGAGGAAGG + Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
915368138 1:155326740-155326762 GAGGGGCAGGGGCCTGAGGTGGG - Exonic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915475324 1:156149769-156149791 GTGGGCAAGGGAGCTGAGCAGGG + Intronic
915490213 1:156246486-156246508 CTGGGGAAGGGGACTCCAGATGG + Intronic
915565063 1:156708389-156708411 CTGGGGAAGGGGACTAACCAAGG + Intergenic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915601172 1:156924144-156924166 GTGGGAAGGGAGGCTGAGGATGG - Intronic
915614382 1:157025496-157025518 GTGGGGAGGGGTGCTGAGGAGGG - Intronic
915730027 1:158046678-158046700 GTGGGGAAGGTCTTTGAGGAGGG + Intronic
916473968 1:165150627-165150649 GAGGGGCAGGGGGCTGAGGCAGG + Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917817341 1:178724925-178724947 GGGGGGAAGGGGTAGGAGGATGG - Intergenic
917965864 1:180178184-180178206 GTGGGGAGGGGGACTGGGAAGGG - Intronic
918083242 1:181223437-181223459 GTGGGGAGTGAGACTGAGGCGGG + Intergenic
918332344 1:183472371-183472393 GGGGGGAGGGGGAGGGAGGAGGG - Intronic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918983751 1:191596508-191596530 GAGGGGGAGGGGACTAAGGGTGG - Intergenic
919284209 1:195532543-195532565 GATGGGAAGGGTACTGGGGAGGG + Intergenic
919357874 1:196549004-196549026 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
919669287 1:200324242-200324264 GTGTGGGAAGGGACTGAGCATGG + Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919936674 1:202255480-202255502 GCGGGGAAGGGCGCTGGGGAGGG - Intronic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
920730978 1:208484128-208484150 GTAGGGAAGGGGAGAGAGAAAGG + Intergenic
920748110 1:208647978-208648000 TGGGGGAAGGGGACTGAAGGGGG + Intergenic
920858816 1:209688125-209688147 GTTGGGGAGGGGCCTGAGTAAGG - Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921070740 1:211655811-211655833 GTGGGCTAGGGGGCTGGGGAGGG - Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
921875315 1:220189087-220189109 GAAGGGAATGGGACTGAGGGGGG + Intronic
921936991 1:220804687-220804709 GTGGGGAGGGGGACAGATGGGGG - Intronic
921960242 1:221026599-221026621 GTGGGCAAGGGAAATCAGGAAGG - Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922887216 1:229029286-229029308 GTGGGGAAGGCAAGTGAGGACGG - Intergenic
922986025 1:229866411-229866433 GTGTGGAAGGGGACCCAAGAGGG - Intergenic
923482499 1:234397558-234397580 GGGGGGAAGGGGGATGGGGATGG + Intronic
923648046 1:235844749-235844771 GGGGGGAAGGGGACCAAAGAGGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923765761 1:236891030-236891052 AGAGGGAAGGTGACTGAGGAGGG + Intronic
924113877 1:240726736-240726758 GTGGGGAATTGGACTGGAGATGG + Intergenic
924330321 1:242935031-242935053 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063390266 10:5645712-5645734 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063390394 10:5646368-5646390 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063654099 10:7969897-7969919 GGGAGGAAGGAGACGGAGGAAGG - Intronic
1063685071 10:8229141-8229163 GTGTGGAAAGGCACTGTGGAAGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064403517 10:15040573-15040595 GTGGGGAAGGGAAGGAAGGAAGG - Intronic
1064795197 10:19004289-19004311 GGGTGGAAGGGGATAGAGGAAGG - Intergenic
1064975035 10:21105328-21105350 GGGGGGTAGGGGACTGGGGGAGG - Intronic
1065277450 10:24099326-24099348 GTGGGGTAGGGGAATGGGGGAGG - Intronic
1065327565 10:24562689-24562711 ATGGGGAAAGGAACTGAAGATGG - Intergenic
1065563756 10:26988957-26988979 GTGGGGAAGGGGAGTGTTGCAGG + Intergenic
1065762434 10:28994645-28994667 GTGTGGAAGGGTAGTGAAGAGGG - Intergenic
1066502551 10:36008253-36008275 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1067021183 10:42799716-42799738 GGGAGGAAGGGGACTGTGGCTGG - Intronic
1067066251 10:43105711-43105733 GTGGGCGTGGGGACTGAGGTAGG + Intronic
1067098040 10:43315190-43315212 GGCGGGAGGGGGGCTGAGGAGGG + Intergenic
1067141016 10:43656683-43656705 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1067181085 10:43986485-43986507 GTGGGGAAGGGCAGGGAGAATGG - Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067731232 10:48812890-48812912 GTGGGAAAGAGGAGTGAGTAAGG - Intronic
1067763279 10:49066175-49066197 GTGGGGAAGGGAAATGAATACGG - Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068100142 10:52542405-52542427 TTGGGGAATGGGTCTGAGAAAGG + Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1069023961 10:63521085-63521107 GTGGGGCAGGAGGCTGAGGAAGG - Intergenic
1069152693 10:64984910-64984932 GCGTGGAAGGGGACTGGAGAGGG + Intergenic
1069509786 10:69033442-69033464 GTGGTGGAGGGGAATGAGTAGGG - Intergenic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1069601216 10:69709444-69709466 GTGGGGAAGGGCACAGAGCCAGG + Intergenic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1069819340 10:71217838-71217860 GTGGAGATGGGGACTGGGGGTGG - Intronic
1069851686 10:71409460-71409482 GTTGGGTAAGGGACGGAGGATGG + Intronic
1069973967 10:72198062-72198084 GGGGGGAGGGGGAACGAGGAAGG + Intronic
1069984136 10:72272614-72272636 GTGGGGATGGGGGTTGCGGAGGG + Intergenic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070312600 10:75284410-75284432 GTGGGGAAGGGTACTGGGTTGGG + Intergenic
1070328804 10:75403970-75403992 GTGGGGGAGGGGAGTGAGATGGG - Intergenic
1070329963 10:75409611-75409633 GAGGGGAACGGGCCTCAGGAGGG + Intergenic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1070519075 10:77236059-77236081 GGGGAGCAGGGGACTGAGGCTGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070653158 10:78252465-78252487 GCCGGGAAAGGGATTGAGGAGGG - Intergenic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071606949 10:87000916-87000938 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1071906293 10:90177891-90177913 GTTGGGCTGGGGACAGAGGAAGG + Intergenic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072332185 10:94364569-94364591 GTGTGGAAGGAGACAGAGCAAGG - Intergenic
1072651838 10:97302090-97302112 GTGGGAAAGGGGACTCAGTGAGG + Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1073535849 10:104275759-104275781 TGGGTGAAGGGGACTGGGGAGGG - Intronic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074254019 10:111782440-111782462 ATGGGAAAGGGGACATAGGAAGG + Intergenic
1074353406 10:112759751-112759773 GGTGGGAAGGGGGCTGGGGAAGG - Intronic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074988548 10:118680335-118680357 GTGGGGCAGGGGAGTGAAAATGG + Exonic
1075001562 10:118802495-118802517 GTGGGGAGGAGGACAGAGGGAGG + Intergenic
1075058450 10:119237687-119237709 GAGGGGGAGGGAACTGAGGAGGG + Intronic
1075270774 10:121048289-121048311 GCAGGGAAGGAGATTGAGGAAGG + Intergenic
1075513760 10:123093453-123093475 GTGGGGAGGGGGACCGAGAAGGG + Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1075646792 10:124102201-124102223 GTGGGAGAGGGGCCAGAGGATGG + Intergenic
1075838620 10:125477723-125477745 GGGGGGAAGTGGAGTGGGGATGG + Intergenic
1076053382 10:127352320-127352342 GTGGGGAGGGGCAAAGAGGATGG + Intronic
1076071172 10:127490976-127490998 TAGGGAAAGGGGACTGGGGAGGG - Intergenic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076542640 10:131223922-131223944 GTGGGGATGTGGCCTGGGGAGGG - Intronic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1076938860 10:133586879-133586901 GTGGGGAGGGGCACAAAGGAGGG - Intergenic
1077077238 11:707223-707245 GTGGGAAAGGAGACCGAGGCAGG - Intronic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077147774 11:1053598-1053620 GTGGCTGAGAGGACTGAGGACGG + Intergenic
1077318337 11:1929032-1929054 GTGGGCAAGGGGCCTGTGGCGGG - Intronic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1078140946 11:8692620-8692642 GAGGGGAAGGAAACTTAGGATGG + Intronic
1078178669 11:8990863-8990885 GTTGGGAGTGGGACTGAGAAGGG - Intronic
1078335488 11:10459787-10459809 GTGGGTGAGGGGACAGAGGCAGG + Intronic
1078812635 11:14783608-14783630 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1078917654 11:15795138-15795160 CTGGGGAGTGGGACTGGGGATGG + Intergenic
1078929291 11:15901133-15901155 CTGGGGCAGGGGCCTGGGGAAGG - Intergenic
1078996147 11:16701780-16701802 GTGGGAGGGGGGACTGAGGCAGG + Intronic
1078999476 11:16739053-16739075 GTAGGAAGGGGGATTGAGGAAGG + Intronic
1079130572 11:17744707-17744729 GTGGGGAAGGGCGCAGGGGATGG + Intronic
1079162624 11:18009068-18009090 TTGGGGAAGGGATTTGAGGAGGG - Intronic
1079677980 11:23256014-23256036 GCTGGGAAGGGTAGTGAGGAAGG + Intergenic
1079898611 11:26152429-26152451 GGGGGGGAGGGGAGGGAGGAAGG + Intergenic
1080101973 11:28470213-28470235 GGGGGTAAGAGGACTGAGCAAGG - Intergenic
1080749067 11:35136095-35136117 GTTGGGATGGGGCCTGGGGAGGG + Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081231984 11:40596602-40596624 GCTGGGAAGGGGAGTGGGGAGGG - Intronic
1081342960 11:41950093-41950115 GGGGGGAAGGGGCATGAGGTTGG + Intergenic
1081713068 11:45230412-45230434 GTGGGGAAGTGGAATGGGGCTGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081772592 11:45659019-45659041 GTGGGGACGAGGACTGGGGGTGG + Intronic
1081870888 11:46382009-46382031 GTGGGGAAGGGGACGGGCCAGGG + Intronic
1081875373 11:46404794-46404816 GGGGGGATGGGGACAGAGGGTGG - Intronic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082668540 11:56005622-56005644 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1083151322 11:60793573-60793595 GTGGGGAAGGGGCTGGATGAGGG + Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083281364 11:61629088-61629110 GTGGGGAAGGGGGCTACAGAGGG + Intergenic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1083749536 11:64753726-64753748 GTGGGGCTGGGGACTGGGGATGG - Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084021867 11:66422571-66422593 GTGGGAAATTGGACCGAGGAAGG - Intronic
1084185238 11:67467947-67467969 GTGGGGTGGGTGACTGAGCAGGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084461226 11:69297763-69297785 CTGGGGTAGGGGAGTGAGGCAGG - Intronic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1084733578 11:71089962-71089984 GCAGGGCAGGAGACTGAGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084978857 11:72817860-72817882 GTTGGGAAGGGGTCTGAAAATGG + Intronic
1085047792 11:73363430-73363452 GTGTGGCTGGGCACTGAGGATGG + Exonic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085293085 11:75414165-75414187 GTGGGGAGGGGCATTGAGTATGG - Intronic
1085399893 11:76229671-76229693 GGAGGGAAGGAGACTGAGGAGGG + Intergenic
1085414323 11:76310213-76310235 GTGGAGAATGGGAGTGAGGTCGG - Intergenic
1085439281 11:76543634-76543656 GGACGGAAGGAGACTGAGGAGGG - Intronic
1085470149 11:76752565-76752587 GTGGGAGAGGGGACTCAGGCTGG + Intergenic
1085749128 11:79144778-79144800 GTTGGGAAGGGTAGTGAGCATGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086631827 11:89028929-89028951 GGGGGGTGGGGGACTGGGGAAGG - Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087278964 11:96188736-96188758 GTGTGGGAGGGGACTGACAATGG + Intronic
1087990665 11:104743111-104743133 GTGGGGATGGGGGGTGGGGAAGG + Intergenic
1088058286 11:105611179-105611201 GAGGGGAAGGGAACTGCTGAAGG - Intronic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088471986 11:110196649-110196671 GTTGGGAAGGGGCCTGAGGTGGG - Intronic
1088899978 11:114108548-114108570 GCAGGGAAGGGGAATGTGGAGGG - Intronic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089194539 11:116686560-116686582 GTGTGGAAGGGGACTGCAGCTGG - Intergenic
1089288002 11:117420017-117420039 CTGGGGAAGGAGGCTGAGGTGGG + Intergenic
1089496906 11:118912561-118912583 CTGGGGGAGGGAGCTGAGGAAGG + Intronic
1089560427 11:119340657-119340679 GAGGGGAAAGGGGCTGGGGAGGG - Intronic
1089586490 11:119512862-119512884 GTGGGAGAGGGGCCTGAGGCTGG + Intergenic
1089787692 11:120919955-120919977 GTAGGTAGGGGGAGTGAGGAAGG + Intronic
1090097213 11:123754129-123754151 GTGGTGAAGGGGATTGCAGATGG + Exonic
1090359949 11:126165338-126165360 GTGGAGTAGGGGACTAAAGAAGG + Intergenic
1090636897 11:128694965-128694987 GTGCGGACGGGGGCTGGGGAAGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091042212 11:132292397-132292419 GTGGGGGAGGGGCCGGAGGAGGG - Intronic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1091692090 12:2604254-2604276 GAGGAGAAGGGGACTGAGACAGG + Intronic
1091836341 12:3588757-3588779 ATGGGGAAGGGAACTGTGGGAGG + Intronic
1091840517 12:3617151-3617173 GTGGGGAAGGATTATGAGGAAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1091924117 12:4329966-4329988 ATGGGGAATGGTACTGGGGAGGG + Intronic
1092218272 12:6697273-6697295 GTGGGGAAGGTGAGTGGGAAAGG - Exonic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092923187 12:13250604-13250626 GTGAGTCAGTGGACTGAGGAGGG - Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093202286 12:16202961-16202983 GTGGGGAAGGGGACTGGGTGGGG + Intronic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1094481737 12:30888820-30888842 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
1095348262 12:41179084-41179106 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1095701444 12:45194959-45194981 GTGGGGAAGGAGCCTGAGAGCGG - Intergenic
1095742866 12:45625848-45625870 GGTGGGAAGGGGACTGAAGTGGG + Intergenic
1095964484 12:47857695-47857717 GGTGGGAAGGGGAGTCAGGAGGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096227700 12:49877159-49877181 CTGGGGTGGGGGACTGAGGGAGG - Intronic
1096608619 12:52786296-52786318 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
1096799823 12:54102806-54102828 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1096848640 12:54421315-54421337 GTGGGGAGGAGGACTGGGGCAGG - Intergenic
1096870148 12:54587985-54588007 GTGCGGGAGGGGCCTGGGGAGGG - Intronic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096967434 12:55639364-55639386 GTGGGGAAGGGGACATAGGGAGG + Intergenic
1097623544 12:61971722-61971744 GTGGGGTAGGGGGCTGGGGGAGG + Intronic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1098150885 12:67545121-67545143 GTGGGAAAGGGGACAGAGAAGGG + Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099271604 12:80517648-80517670 GGTGGGAAGGGTAGTGAGGAGGG - Intronic
1099583008 12:84477179-84477201 GTGGGGAGGGGGCCAGGGGAAGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099885705 12:88527432-88527454 CTGAGGAAGGGTACTGAAGAGGG + Intronic
1100006264 12:89899374-89899396 GTGGGCAGGGGAAATGAGGAAGG - Intergenic
1100158675 12:91832088-91832110 GTGGGGTGGGGGACTGAGGGAGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100329335 12:93570328-93570350 CAGGGGGAGGGGACTAAGGACGG + Intronic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100643219 12:96502703-96502725 GTGGGGGAGGGAGCTGAGGAAGG + Intronic
1100671411 12:96816969-96816991 GTCGGGAATGGGAGTGAAGAGGG - Intronic
1100756678 12:97758918-97758940 GTGGGGAAGGGGAATGATACTGG - Intergenic
1100794338 12:98164482-98164504 CTGGGGGAGGGGACTGGAGATGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101565498 12:105901225-105901247 GTGAGGAGGGGAACAGAGGAGGG + Intergenic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101958753 12:109232498-109232520 CTGGGGCCGGGGCCTGAGGAGGG - Intronic
1102112596 12:110376025-110376047 TGGGGGAAGGCCACTGAGGAGGG - Intronic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102222451 12:111203751-111203773 GTGGGGAAGGGGCTGTAGGAGGG + Intronic
1102598843 12:114013161-114013183 GTGGGGGAGGGGGATGGGGAGGG + Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102864993 12:116367336-116367358 GTGGGCATGGGGCCTGGGGATGG + Intergenic
1103204896 12:119120901-119120923 GAGGGTAAGGGGAGTGACGATGG + Intronic
1103330674 12:120151662-120151684 GTGGGGCAGGGGACCAAGGAAGG + Intronic
1103730175 12:123022149-123022171 GCGGGGAAGGGCGGTGAGGAGGG + Intronic
1104158296 12:126154191-126154213 GTGGGGAAGGGAGCTGAGGGTGG - Intergenic
1104339644 12:127936145-127936167 GTTGGGATGGGAACTGAGCATGG + Intergenic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104957729 12:132474630-132474652 GAGGGGAAGGGCACCGCGGAGGG - Intergenic
1105040093 12:132955125-132955147 GTTGGGAAGGGGAAGGAGAACGG + Intronic
1105604019 13:21911958-21911980 GGGGGGAAGGGGGCACAGGAGGG - Intergenic
1105675080 13:22662340-22662362 TTCGGGGAGGGGACAGAGGACGG + Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1105929236 13:25036739-25036761 GTGGTAATGGGGACTCAGGATGG + Intergenic
1106062900 13:26312301-26312323 GTGTGGAAGGGGACTCAAGTGGG - Intronic
1106609151 13:31262052-31262074 GTGGGGAAGGAGACAAAGCATGG + Intronic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107087984 13:36446656-36446678 GTGGGGATGGGGCCCGAGGTGGG + Intergenic
1107214676 13:37902508-37902530 GTGGGGTGGGGGGCTGGGGAAGG + Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107904102 13:45046524-45046546 GGAGGGAAGGGGTGTGAGGAGGG - Intergenic
1107913099 13:45123918-45123940 GTGTGGTTGGGGACTGAGTATGG + Intronic
1107955412 13:45506570-45506592 CTGGGGTAGGGGTGTGAGGATGG + Intronic
1107986225 13:45778611-45778633 GTGGGAGAGGGGACTTTGGAAGG - Exonic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1109556916 13:63988463-63988485 AAGGGGAAGGGAACTGATGAAGG + Intergenic
1109837920 13:67883172-67883194 GCTGGGAAGGGGGCAGAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110871404 13:80456577-80456599 GTGGGGAAGGGGGTTGAGATGGG - Intergenic
1110894264 13:80729423-80729445 GGGGTGAAGGGCAGTGAGGAAGG + Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111530346 13:89528213-89528235 GTAGGGAAGGGTAGGGAGGAAGG + Intergenic
1111588527 13:90312609-90312631 TTTGGGAAGGGTCCTGAGGAAGG + Intergenic
1112177105 13:97036586-97036608 GAGGGGAAGGGGAATGGGAAGGG + Intergenic
1112339279 13:98538980-98539002 GTGGGGAGGGGGACACAGAAAGG + Intronic
1112881908 13:104118004-104118026 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113339978 13:109412818-109412840 GTTGGGAAGGGGAGTGAGCCTGG + Intergenic
1113541405 13:111112587-111112609 GTGAGGAAGGGGAGTGAAGCAGG - Intergenic
1113613288 13:111663305-111663327 GAGGGGAAGGGGAATGGGAAGGG - Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1114250649 14:20957295-20957317 GTCGGGAAGGGGTCAGTGGATGG - Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114507116 14:23225649-23225671 GCGGGGAAGGGTAGTGGGGATGG + Intronic
1114559706 14:23580951-23580973 GTGGGGTAGGGGGGTGAGGTGGG - Intergenic
1114566624 14:23637962-23637984 GTGTGGAAGGGGACTCAAGCAGG - Intronic
1114649760 14:24277051-24277073 GTGGGCATGGAGAGTGAGGATGG + Intergenic
1114727161 14:24950884-24950906 GTCGGGAAGGGGACTGGGGGAGG - Intronic
1115227680 14:31121271-31121293 GTGTGGAAGGGGTGAGAGGAGGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116384602 14:44314905-44314927 GTGGGGTGGGGGACGGGGGAAGG + Intergenic
1116386312 14:44334663-44334685 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116513015 14:45770063-45770085 GTGGGGTGGGGGACGGGGGAGGG - Intergenic
1116641463 14:47469297-47469319 GTGGGGTCGGGGAGTGGGGAGGG - Intronic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1116987719 14:51239112-51239134 GTGGGGAAGGGGACTAATTGGGG + Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1118390678 14:65292956-65292978 GTGGGTTAGGGAACTGAGAAGGG - Intergenic
1119125047 14:72117610-72117632 GTGAGGAAGGGAAGAGAGGAGGG + Intronic
1119184813 14:72632756-72632778 GAGGGGAAGGGGAGAGAAGAGGG + Intronic
1119424452 14:74526741-74526763 GAGGGGCAGGGGACAGAGTAGGG + Intronic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119636665 14:76278902-76278924 GTGGTGAAGGGTAGTGAGGCTGG - Intergenic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1119777534 14:77258193-77258215 TTGGGGGAGGGGGCTGAAGAGGG - Exonic
1119793581 14:77376504-77376526 CTGGGGCAGGGGACTGAGATGGG + Intronic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119837249 14:77761432-77761454 TCGGGGAACGGGACTGAGTAAGG - Intronic
1120708079 14:87765284-87765306 GTGGGGAGAGGGACAGAGGGAGG + Intergenic
1120881717 14:89418915-89418937 GTGGGGTTGGGGGCTGGGGATGG - Intronic
1120887000 14:89459675-89459697 GTGGGCCAAGGGAGTGAGGAAGG - Intronic
1120944574 14:89982124-89982146 GTGGGGCAAGGGAGTGGGGAGGG - Intronic
1121103940 14:91268693-91268715 GGGTGGGAGGGGAGTGAGGATGG + Intergenic
1121241333 14:92432066-92432088 GTGTGGATGGGTACGGAGGATGG + Intronic
1121328173 14:93033931-93033953 GTGGGACTGGGGACTGAGGATGG + Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1122121144 14:99554133-99554155 ATGGGGCAGGGGACTGAAGCTGG - Intronic
1122182975 14:99969351-99969373 GAGGGGGAGGGTACTGAAGAAGG + Intergenic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122300405 14:100728063-100728085 GCGGGGACGGGGACCGTGGAGGG - Intronic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122919475 14:104874121-104874143 TTGGGGAGGGGGTCTCAGGACGG + Intronic
1123035103 14:105468794-105468816 GTGGGGAAGGGCAGTGAGTGGGG + Intronic
1123587472 15:21772747-21772769 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123624110 15:22215312-22215334 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123996349 15:25720558-25720580 GAGGGGAAGGGGAGGAAGGAGGG + Intronic
1124203397 15:27697662-27697684 GTGGGGAAGTGGAGTGGGGGAGG - Intergenic
1124702786 15:31931284-31931306 GGGAGGAAGGAGAATGAGGATGG + Intergenic
1124804475 15:32867616-32867638 GGGGGGCAGGGGGCTGAGGCAGG - Intronic
1124901325 15:33825649-33825671 CTGGGGATGGTGACTGAAGAAGG + Exonic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125310409 15:38372978-38373000 GTGGGGGAGGGGGCGGTGGAGGG - Intergenic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125762297 15:42104923-42104945 GTGAGGAAGAGGGCTTAGGATGG - Intergenic
1125957214 15:43798918-43798940 GGTGGGGAGGGGACAGAGGAGGG - Exonic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126214734 15:46142297-46142319 GTGGGGTGGGGGACTGAGGGAGG - Intergenic
1126217433 15:46172399-46172421 GTGGCCTAGAGGACTGAGGAAGG + Intergenic
1126333843 15:47564978-47565000 GTGGGAAAGGGAACTGAAAAGGG - Intronic
1126404950 15:48314125-48314147 GTGTGGAAGGGCCCTGAGCAGGG - Intergenic
1127121639 15:55777054-55777076 GTGGGGAAGGGGAGAGAGGGAGG + Intergenic
1127260788 15:57324562-57324584 GTGGGGGAGGGACCTGAGGGAGG - Intergenic
1127933136 15:63610865-63610887 GTGGGGATGGAGACAGAGGGAGG + Intronic
1127967915 15:63937560-63937582 GTGGGGAGGGAGCCAGAGGAGGG - Intronic
1128199981 15:65796561-65796583 TTGGGGAACGGGGCTGAGGGTGG + Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1128521844 15:68380550-68380572 GTGTGGCAGGGCACAGAGGAAGG + Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1128939759 15:71778522-71778544 GTGGGGGAGGCGGCTGAGGCAGG - Exonic
1129077397 15:73008669-73008691 GGGAGGAAGTGGACAGAGGAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1129333341 15:74838751-74838773 GCAGGGAAAGGGCCTGAGGAGGG + Intronic
1129663942 15:77568834-77568856 GTGCCAAAGGGAACTGAGGAGGG - Intergenic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130174392 15:81553269-81553291 ATGGGGAAGGGGAATCAGCACGG - Intergenic
1130800406 15:87256908-87256930 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
1130991264 15:88877410-88877432 GAGGGGAAGGGGAACGGGGAGGG + Exonic
1131055522 15:89372187-89372209 GTGTGGAAGGGGCCTGGGTAGGG + Intergenic
1131139298 15:89964090-89964112 GTAGGGAGGGGGACTGCTGAGGG - Intergenic
1131624122 15:94099964-94099986 GTGTGGCAAGGAACTGAGGAAGG + Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1131794021 15:95994863-95994885 GTGGGGGAGGGGGGTGGGGAGGG - Intergenic
1132070370 15:98771366-98771388 GTGAGGAAGGGGAGAGAGGGTGG - Intronic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132399306 15:101495758-101495780 GGGGGGAAGGGAAGGGAGGAGGG + Intronic
1132616193 16:842174-842196 GTGGGGCGGTTGACTGAGGAGGG + Intergenic
1132672524 16:1107683-1107705 GTGGGGCGGGGGACTGTGGGGGG - Intergenic
1132709070 16:1258599-1258621 ATGGGAGAGGGGACTCAGGATGG - Exonic
1132709725 16:1261124-1261146 GTGGGGAAGGGGCCGGGGAAGGG - Intergenic
1132711671 16:1271623-1271645 GTGGGTAAAGGGCCTGGGGACGG + Intergenic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132941907 16:2512733-2512755 CTGGGGAAGGGGCTTGAGGGAGG + Intronic
1132989907 16:2787190-2787212 GAGGAGGAGGGGGCTGAGGATGG - Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133265319 16:4579940-4579962 GCCGGGAAGGGGCCTGAGGGAGG - Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133578943 16:7124492-7124514 GAGGGGAGGGGGAGCGAGGAAGG - Intronic
1133668115 16:7990709-7990731 GTTGGGAACGGCAGTGAGGAAGG - Intergenic
1133997926 16:10762124-10762146 TGGTGGCAGGGGACTGAGGAGGG + Intronic
1134040247 16:11062897-11062919 GTGGGGGAGGGCAGTGGGGAGGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134406331 16:13962220-13962242 GTGGGGAATGGGAGTGAGACTGG - Intergenic
1134455573 16:14392926-14392948 GTGGTGCAGGAGGCTGAGGAGGG + Intergenic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134925284 16:18153732-18153754 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135244603 16:20844872-20844894 TTGGGGAAGGAAACTGGGGATGG + Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135465404 16:22680553-22680575 GTGGGGAGGGAGGCAGAGGATGG - Intergenic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1135611181 16:23868755-23868777 GTGGGGATGGAGACTGGGGCCGG + Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137706603 16:50539812-50539834 GTGGGGGGGGGGCCTGGGGAAGG + Intergenic
1137735234 16:50718918-50718940 GTGGGGAAGGGAGCTGGGGGAGG + Intronic
1137971039 16:52985395-52985417 GGGGGGTAGGGGGCTGAGGCAGG - Intergenic
1137997606 16:53236184-53236206 ATGGGAAAGGGTACTGATGAGGG - Intronic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1138245244 16:55462561-55462583 CCCAGGAAGGGGACTGAGGAGGG - Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138374203 16:56551549-56551571 GTGGGGGAGGGGATTGGGGCAGG - Intergenic
1138520318 16:57567363-57567385 GTGGGGAAGGGGACTTGGAGAGG + Intronic
1138532033 16:57639756-57639778 GAGGGGAAGGGGAGTGAAGGAGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1138624260 16:58236658-58236680 ATGGGGAAGGGGGTTGAGGGAGG + Intronic
1138693489 16:58790462-58790484 GTGTGGAAGGGGACCCAGGCCGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139087281 16:63602565-63602587 GTGGGGATGGGGGGTGAGAATGG + Intergenic
1139512700 16:67436417-67436439 GTGGGGAATGGGGCTGGGAATGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1140472900 16:75225041-75225063 GTGGGAGAGGGGACTAAGGAAGG - Intergenic
1140586590 16:76299994-76300016 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1140882790 16:79214141-79214163 GAGGGGAAGGGGAATAAGAATGG - Intergenic
1141025095 16:80539465-80539487 GTGGGGAAGGAGTCTGAGTCTGG - Intergenic
1141330794 16:83108942-83108964 GAGGGGAAGGGAGCTGATGAGGG - Intronic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141672258 16:85498248-85498270 GTGGGGAAGGGGACTCACTGAGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141694098 16:85611856-85611878 GCGGGGAGGGGGAGGGAGGAAGG + Intronic
1141926241 16:87171660-87171682 CTGGGGAAGGGGGGTCAGGAAGG + Intronic
1142119215 16:88377647-88377669 GGGAGGATGGGGAGTGAGGAAGG - Intergenic
1142217248 16:88835902-88835924 GTGGGGACGGGGACCGTGGGAGG - Intronic
1142412760 16:89924566-89924588 GAGGGGAAGGGGCCAGAGAAAGG + Intronic
1203093192 16_KI270728v1_random:1229422-1229444 GTGGGGACGGGGGCTCAGGAAGG + Intergenic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142759617 17:2035052-2035074 TTGGGGAAGGGGGTGGAGGAGGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143651736 17:8267520-8267542 GTGGGGAGGGGGAGTGTGGGTGG - Intronic
1143727646 17:8860445-8860467 GTGGGGAAGGGGGCTGGGGCTGG - Intronic
1143942149 17:10553615-10553637 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1143965814 17:10755929-10755951 GGGGGGAGGGGGACAGAGAAAGG - Intergenic
1144002358 17:11067308-11067330 GTGGGGTGGGGGACGGAGGAGGG - Intergenic
1144004970 17:11091384-11091406 GTGGTGCTGGGGGCTGAGGAGGG + Intergenic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144317969 17:14081998-14082020 GTGGGGCAGGGGGCTGTGAAAGG + Intronic
1144501897 17:15795452-15795474 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1144600443 17:16608215-16608237 GTGGGGAAGGACACTCAGGTTGG + Intergenic
1145014573 17:19387845-19387867 CTGGGGAGGGGGACTGGAGAGGG - Intergenic
1145077976 17:19870792-19870814 GCCAGGAATGGGACTGAGGAAGG + Intergenic
1145923897 17:28631749-28631771 GAGGGGAATGGAACTGAGAAGGG + Intronic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146811925 17:35910652-35910674 GTAGGGAAGGGGAATCAGGCTGG + Intergenic
1147047377 17:37763431-37763453 CTGGGGAAGGAAACTGAGGCTGG - Intergenic
1147153254 17:38530536-38530558 GCGGGGACGGGGGCTCAGGAAGG + Exonic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1147160891 17:38568925-38568947 ATGGGGCAGGGGTCGGAGGAGGG + Intronic
1147283286 17:39380587-39380609 GGGGGGAAGGGAGCTGAGCATGG - Intronic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147966333 17:44196224-44196246 GTGGGGAAGGGGGGTGGGGGAGG - Intronic
1148109117 17:45134909-45134931 GCTGGGAAGGGTACTGGGGAGGG - Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148558031 17:48590197-48590219 GTGGGGAAGGGGGCAGAGGTAGG - Intronic
1148615018 17:48995685-48995707 ATGGGGTCGGGGACTGGGGAAGG + Intergenic
1148990882 17:51666276-51666298 GAAGGGAAGGGGAATGAGGTAGG + Intronic
1149090647 17:52774290-52774312 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
1149302506 17:55318164-55318186 GAGGGAAAGGGGGCAGAGGATGG + Intronic
1149556713 17:57578561-57578583 GAGGGGAAGGGGACGGGAGAAGG + Intronic
1149572154 17:57679633-57679655 GTTGGGATGGGGAGTGAGGCTGG - Exonic
1149781254 17:59398186-59398208 GTGAGGGAGGGGACTGGGTAGGG + Exonic
1150126553 17:62639230-62639252 GTTGGGGAGGGGGCTGAGGCAGG + Intronic
1150140879 17:62727622-62727644 GTGGGAAAGGAGACTGATGGGGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150449880 17:65257856-65257878 GTGGGGATGGGGGCTGAAGTAGG + Intergenic
1150603038 17:66667115-66667137 GTGGGGGAAGGGACTGGGCAGGG - Intronic
1150656836 17:67044899-67044921 GTGGGGATCGGGACGGAGGGTGG - Intronic
1150675709 17:67244913-67244935 GAGGGGAAGGGGACTAAGTAGGG + Intronic
1150683652 17:67303085-67303107 TTGGGGAAGGGAGCTGGGGATGG - Intergenic
1150711147 17:67531888-67531910 GAGGGGAGGGGGAGAGAGGAAGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1150790145 17:68196555-68196577 GTGGGGAAGGGGACAGGGTGGGG + Intergenic
1150811462 17:68360362-68360384 GTGGGGGAGGGGCTTGAGGCAGG - Intronic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151550653 17:74820750-74820772 GTGGGAAACGGGGCTGGGGAAGG - Intronic
1151556046 17:74847261-74847283 GTGGGGGGGGGCACTGAGGGTGG - Intronic
1151678968 17:75614105-75614127 AGGGGGCAGGGGGCTGAGGAAGG - Intergenic
1151928317 17:77214627-77214649 GTGGGGCCGGGGGCTCAGGAGGG + Intronic
1151958486 17:77392638-77392660 GAGGGGGAGGGGACTGGGAAAGG + Intronic
1151971328 17:77458983-77459005 GTGGGCGTGGGGACAGAGGAGGG + Intronic
1152187466 17:78866873-78866895 GAGGGGGAGGGGAGTCAGGAGGG + Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152238377 17:79149958-79149980 ATGGGGATGGGGGCTGAGGGTGG + Intronic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1152329005 17:79659823-79659845 GGGGGGAAGGGGAGGGAAGAGGG - Intergenic
1152635654 17:81429593-81429615 TGGGGGAAGGGGAGTGAGGTGGG + Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152757956 17:82094912-82094934 GTGGGCAAGGGTAGTGGGGAGGG + Intronic
1152829198 17:82486695-82486717 GTGGAGCTGGGGCCTGAGGAAGG + Intronic
1152849919 17:82627484-82627506 GTGGGGAAGGTGCCCGAGGGCGG - Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152870489 17:82751100-82751122 GGGGGGACGGGGACGGGGGACGG - Exonic
1203159869 17_GL000205v2_random:39285-39307 GTGGGGAAGCGGAGGGACGAGGG - Intergenic
1153070088 18:1095670-1095692 CTCTGGTAGGGGACTGAGGAAGG + Intergenic
1153437702 18:5085452-5085474 GTGGGGAAGGGGACCCAAGTGGG - Intergenic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1154177417 18:12094362-12094384 GTGGGGTGGGGGACTGTGGTGGG + Intronic
1154177575 18:12094791-12094813 GTGGGGTTGGGGACTGTGGTGGG + Intronic
1154238283 18:12627203-12627225 GTGGGGTGGGGGAGGGAGGAGGG - Intronic
1154949095 18:21190865-21190887 AGGGGGAAGGGAACTGGGGAAGG - Intergenic
1156304623 18:35865854-35865876 GTGAGGGAGTGGACTGAGGTGGG - Intergenic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157197004 18:45627610-45627632 GTGGGAAGGGGCACTGAGGAAGG + Intronic
1157208116 18:45717847-45717869 GTGGGCCAGGGGAGTGAGGATGG - Intergenic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1157647653 18:49292967-49292989 GTGGGTAAGGGGCTAGAGGAGGG - Intronic
1157744188 18:50120545-50120567 TGGGGGAAGAGGGCTGAGGACGG - Intronic
1157761715 18:50270162-50270184 GTGGGGAAGGTGGCAGAGGCTGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157864184 18:51166745-51166767 GAGGGGAAGGGGGCTGAGCAGGG - Intergenic
1158384322 18:56972049-56972071 GGGGGAAAGGGGACTTAGCAAGG + Intronic
1158439127 18:57457971-57457993 GTGGGGTAGGGGGCTGGGGGAGG + Intronic
1158500392 18:57995701-57995723 GAAGGGAAGAGGAGTGAGGAAGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1158814458 18:61077847-61077869 GAAGGAAAGGGGAATGAGGATGG - Intergenic
1158960207 18:62581962-62581984 TTGGGGAAGGGGACGCAGGCTGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159295589 18:66482740-66482762 GTGGGGTTGGGGAGTGGGGAGGG + Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160785661 19:899314-899336 GTGGGGAAGGGGGCTGGAGTGGG - Intronic
1160899015 19:1417545-1417567 GTGGGGAAGGGGTGTCAGGTGGG + Intronic
1160990308 19:1857667-1857689 GTGGGGAGGGGGGCTGTGGCCGG + Intronic
1161161986 19:2766978-2767000 GTGGGGACGGGGACGGAAGGGGG - Intronic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161250248 19:3276250-3276272 GTGGGGCAGGGCCCTGGGGAGGG + Intronic
1161250367 19:3276657-3276679 GTGGGGACGGGCCCTGAAGAGGG + Intronic
1161274908 19:3410522-3410544 GTGAGGAAGGGGAGACAGGAAGG + Intronic
1161378232 19:3950847-3950869 GTGGGGAGGGGGCCGGAGGGAGG + Intergenic
1161400836 19:4065763-4065785 GAGGGGAGGGGGGCTGGGGACGG + Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161821607 19:6533711-6533733 GAGGGGAAGGGGACTCTGGAGGG - Intronic
1161873934 19:6892967-6892989 GTGGGGAAGGGGGATAAAGAGGG - Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1162184833 19:8896813-8896835 GTGGGGCTGGGGACGGGGGATGG + Exonic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162383735 19:10348427-10348449 GTGGGGTAGGGGCCTGCGGGAGG - Intergenic
1162573217 19:11484151-11484173 GTGGGGACCGAGGCTGAGGACGG + Intronic
1162764304 19:12909009-12909031 GTGGGAAAGGGGACTGTTCAGGG - Intronic
1162931906 19:13961649-13961671 GTGGGCACGGGGACTGGGCAGGG + Exonic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163081872 19:14950144-14950166 GGAGGGAAGGGGGCTGGGGAGGG - Intronic
1163118553 19:15202097-15202119 GTGGGGGTGGGGGCTGAGGAAGG - Intergenic
1163156749 19:15443890-15443912 GTGGGGAGGGGGTCCCAGGAGGG - Intronic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163515137 19:17758269-17758291 GTGGGGGAGGGGGTTGAGCAGGG + Intronic
1163535545 19:17874325-17874347 GTGTGGGAGGGGACTGATGGGGG - Intronic
1163549412 19:17957235-17957257 GTGGGGAAGGGGAAAGGGAAAGG + Intronic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1165066485 19:33232143-33232165 TTGGGGATAGGAACTGAGGAGGG + Intergenic
1165104409 19:33460571-33460593 GTGGGTACGGGGACTGAGACAGG - Intronic
1165143720 19:33718542-33718564 GATGGGAAGGGGACGGAGGGTGG - Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165698331 19:37918184-37918206 GTGAGCAGGGGGACTAAGGAAGG + Intronic
1165782178 19:38441209-38441231 TTGGGGAACGGGTCTCAGGAGGG + Intronic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1166180688 19:41106018-41106040 GTGGGGTGGGGGCCTGGGGAAGG + Intergenic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166338658 19:42123800-42123822 GTGAGTAAGTGGACTAAGGATGG - Intronic
1166379820 19:42350125-42350147 CTGGGGAAGGGGTCACAGGAAGG - Intronic
1166557317 19:43709271-43709293 TTGGGGAAGGGGTTTGGGGAAGG - Intergenic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166766083 19:45252518-45252540 GTGGGGAAGGGGTCTGAGTTTGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1166973951 19:46592470-46592492 GTAGGGAAGCCGACTGAGCATGG + Intronic
1167080508 19:47274022-47274044 ATGGGGAGGGGGCGTGAGGAGGG + Intergenic
1167169552 19:47822027-47822049 GAGGCGGAGGGGACCGAGGAGGG + Intronic
1167255223 19:48423606-48423628 GTGTGCAAAGGGCCTGAGGAAGG + Intronic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167423046 19:49415015-49415037 GAGTGGATGGGGACTGGGGAGGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1167742752 19:51334168-51334190 GTGAGCAAGGGGACTGGGGAAGG - Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168231175 19:55032477-55032499 GGAGGGAAGGGGTCTGGGGAAGG + Intronic
1168296152 19:55378147-55378169 GAGGGGGAAGGGACGGAGGAGGG + Exonic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1202711712 1_KI270714v1_random:22817-22839 GTTGGGAAGGGGGCTGCAGAGGG - Intergenic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925189234 2:1869339-1869361 GTTGGGAAGGGCACTGAGTTGGG + Intronic
925306076 2:2849013-2849035 GCGGGGAAGGGGACCCAGGGAGG + Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
925905129 2:8535552-8535574 GAGAGGAAGGGGGCTGAGGAGGG + Intergenic
926156180 2:10455156-10455178 GTGGGGAATGGGTCTGAGAGCGG + Intergenic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
926693426 2:15753674-15753696 GGGGTGTAGGGGACAGAGGAAGG - Intergenic
926966717 2:18423107-18423129 GGTGGGAGGGTGACTGAGGATGG + Intergenic
927103581 2:19806305-19806327 GTGGGGATGGGGACTCAAGCCGG + Intergenic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
927257477 2:21052580-21052602 GTGGGGATGCGGAGTAAGGATGG + Intergenic
927356286 2:22177412-22177434 GTAGGGCAGGGGACAGAGAAGGG + Intergenic
927561407 2:24076693-24076715 GAGGGGGCGGGGCCTGAGGAGGG + Intronic
927900761 2:26816731-26816753 ATAGGGGAGGGGACAGAGGATGG + Intergenic
928017383 2:27670496-27670518 TTAGGGAAGAAGACTGAGGATGG - Intronic
928371492 2:30743113-30743135 GTGGCAAGAGGGACTGAGGAAGG - Intronic
928406258 2:31017307-31017329 GTGGGCAAGGGAACAGAAGATGG - Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930058023 2:47266817-47266839 GTGTAGATGGGGTCTGAGGATGG + Intergenic
930255535 2:49085963-49085985 GTGGGGGGGGGGAGTGGGGAGGG + Intronic
930472068 2:51829727-51829749 GAAGGGAAGGGAAGTGAGGAAGG - Intergenic
930521884 2:52478089-52478111 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
930569781 2:53070709-53070731 GTGGGGTAGGGGGAGGAGGAAGG + Intergenic
930826322 2:55700287-55700309 GAGGGGAGGGGGAGTGGGGAGGG - Intergenic
930870094 2:56161944-56161966 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
931052331 2:58428554-58428576 GTGGGGGAGGGGGCAGGGGATGG - Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931706578 2:64951472-64951494 GTGGGGGAGGGGACAGAGGTAGG - Intergenic
931781258 2:65580922-65580944 GAGGGACAGGGGACTGAGGTAGG + Intergenic
931799825 2:65747672-65747694 GTAGGGCAGGGGAGGGAGGAAGG + Intergenic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932180585 2:69643175-69643197 GTGGGGGTGGGGGCTGAGGGAGG + Exonic
932316777 2:70790130-70790152 GTCTGGGAGGGGACAGAGGAGGG - Intronic
932579393 2:72983700-72983722 GTGGGGCAGGGGCCTTAGGGAGG - Intronic
932591731 2:73071522-73071544 GGGCGGAAGGGGACTTTGGAGGG + Intronic
932598764 2:73110450-73110472 GTGGGGAGGGTCACTTAGGATGG - Intronic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
932735468 2:74251259-74251281 GGGGGTAGGGGGACTAAGGAGGG + Intronic
932751869 2:74376356-74376378 TGGGGGAATGGGGCTGAGGAAGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932759256 2:74428760-74428782 GTGAGGTAGGGGAATGAGAAGGG + Intronic
933034496 2:77376433-77376455 TTGGGGATGGGGACTGAAAAAGG - Intronic
933326069 2:80839098-80839120 GTTGGGGATGGGAGTGAGGATGG - Intergenic
933710235 2:85319969-85319991 GTGGGGTGGGGTAGTGAGGAAGG + Intronic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
934616775 2:95776215-95776237 GTGGGGATGGGGGCTGCGGGAGG - Intergenic
934644115 2:96048345-96048367 GTGGGGATGGGGGCTGCGGGAGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934750703 2:96792440-96792462 GAGGGGAAGGGGAGCGGGGAAGG - Intronic
934837532 2:97604436-97604458 GTGGGGATGGGGGCTGCGGGAGG + Intergenic
934992363 2:98930501-98930523 GTGGGGATGGGGATGGAGTAGGG - Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935116750 2:100143594-100143616 GTGGGGTAGAGGACAGAGCAGGG - Intergenic
935308386 2:101759615-101759637 GGAGGGAAGGGGAATGGGGAAGG - Intronic
935308416 2:101759672-101759694 GAGGGGGAGGGGAATGGGGAGGG - Intronic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
936317463 2:111435701-111435723 GGGGGGGTGGGGACTTAGGATGG + Intergenic
936351188 2:111713747-111713769 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
936373080 2:111919252-111919274 GTGGGCCAGGGGGCTGCGGAAGG - Intronic
936384525 2:112017049-112017071 GTGTGGAAGGGGACTCAAGCGGG + Intronic
936407838 2:112223108-112223130 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936605350 2:113946863-113946885 GTCTGGAAGGGAACCGAGGAGGG + Intronic
936742338 2:115528209-115528231 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937270117 2:120644293-120644315 GAGGGGAAAGGAACTGAGTAGGG - Intergenic
937440483 2:121911215-121911237 GGGGGGCAGGGGAGTGAGGGCGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937757309 2:125556139-125556161 GTGTGGGAGGGGACTAAGTAAGG - Intergenic
937910376 2:127072812-127072834 GCGGGGCCGGGGAATGAGGAAGG + Intronic
938081048 2:128370330-128370352 GAGGGGCTGGGGTCTGAGGAAGG + Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938779853 2:134575314-134575336 GTGGGGTAGGGGCCTGACCATGG - Intronic
938837094 2:135115950-135115972 GGGGGGAATGGGGCTGATGAGGG + Intronic
938872188 2:135490979-135491001 GTTGGGAAGGGTAGTGGGGAGGG + Intronic
939322955 2:140648288-140648310 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
939348574 2:141001461-141001483 GTGAGGTGGGGGACGGAGGAGGG - Intronic
939365624 2:141226838-141226860 GTGGGGCAGGGGTGTGAGCAGGG - Intronic
939404645 2:141740890-141740912 GGGGGGTAGGGGGATGAGGATGG - Intronic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
940125424 2:150317456-150317478 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940901659 2:159131494-159131516 GGGGGGAGGGGGAGTGATGAGGG - Intronic
940990111 2:160087977-160087999 CTGGGGAAGGGAACCAAGGAGGG - Intergenic
941067455 2:160919430-160919452 ATGGGGAGGGGCCCTGAGGATGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941766918 2:169308364-169308386 GTGGGGTAGGGGAGAGGGGAAGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942313951 2:174682121-174682143 GTGGGGACGGGGGTTGAGGGGGG - Intronic
944069184 2:195650948-195650970 GTGGGGAAGGCGAAGGAGGTGGG + Intronic
944251513 2:197583769-197583791 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
944462938 2:199970765-199970787 GTGGGGTGGGGGAGTGGGGATGG - Intronic
944465204 2:199993724-199993746 GTAGAGAAGGGGACTGGGGGTGG + Intronic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
944665641 2:201956718-201956740 GTGGAGAAGGGCACAGAAGAGGG - Intergenic
944976789 2:205062545-205062567 GAGTGGAAGTGCACTGAGGATGG + Intronic
945102694 2:206275707-206275729 GTGGGGAGGGGGAGGGACGATGG + Intronic
945285997 2:208082312-208082334 GTGGGGAAGGGGCTTGAGATGGG - Intergenic
945361480 2:208900376-208900398 GTGGGAAAGGGGTCGGAGCATGG - Intergenic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945891517 2:215435939-215435961 GTGGGGAAGGGGACGGGTGGAGG + Exonic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946399411 2:219460780-219460802 GAGGGGAAGGCGCCTGAGGAGGG - Intronic
946401836 2:219472359-219472381 GTGGGGAAGGGGTGTGGAGAAGG + Intronic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
946807207 2:223482816-223482838 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
946881296 2:224179721-224179743 AGGGGGAAGGGGACTGAGGGTGG + Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
947421014 2:229941633-229941655 GTGGGGAAGGGGAGATAGGAGGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
947837786 2:233188020-233188042 GGGGGCAGGGGGACTGAGGGAGG - Intronic
947891154 2:233621872-233621894 ATGGGGTGGGGGGCTGAGGAAGG - Intronic
947902292 2:233731427-233731449 GTGGGGTGGGGGACTGGGGGAGG - Intronic
948002565 2:234580366-234580388 GGAGGGAAGGAGACTCAGGAGGG - Intergenic
948079322 2:235192612-235192634 GTGGGGTGGGGGAGGGAGGAGGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948217423 2:236242213-236242235 GTGGCGTGGGGGACAGAGGATGG - Intronic
948236117 2:236391949-236391971 GTGGGGAAGGAGCCTGCAGAGGG - Intronic
948272844 2:236687522-236687544 GTGGGGCTGGGGTCTCAGGACGG - Intergenic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948388908 2:237598248-237598270 GAGGGAGAGGGGACTGAGGTGGG - Intronic
948858164 2:240740252-240740274 GTGGGGGAGGGGACACAGGCAGG + Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1168877770 20:1183033-1183055 GCAGGGAAGGGGGCTGAGGTGGG - Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1169369813 20:5020110-5020132 GGAGGGAAGGGGAGTGTGGAGGG - Intergenic
1169638581 20:7722566-7722588 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1170026345 20:11892311-11892333 GTTGAGTAGGGGACTGAGGTAGG - Intronic
1170031412 20:11947977-11947999 GAGGGGAAGGCGACTGGTGAAGG + Intergenic
1170169371 20:13393747-13393769 GTGTGGTAGGGGACTGAGTGTGG - Intronic
1170639108 20:18136329-18136351 GTGGGTTGGGGGACTGAGGGAGG - Intergenic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170976319 20:21168062-21168084 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1171118443 20:22547525-22547547 GTGGGGAAGAGGGCAGTGGAAGG + Intergenic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171136108 20:22695980-22696002 GTAGGTAAGGGGACAGAGGCTGG + Intergenic
1171796616 20:29571541-29571563 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1171851625 20:30312625-30312647 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1171958695 20:31478014-31478036 TTGGGGGAGGGTGCTGAGGATGG - Intronic
1172047268 20:32089233-32089255 GTGTGGGAGGGGACTGACCAAGG + Intronic
1172083021 20:32357921-32357943 GTGCGGGTGGGGAGTGAGGATGG - Intergenic
1172114061 20:32563263-32563285 GTGGGGAGGGAGACTCGGGAGGG + Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172303686 20:33866698-33866720 GGGGGGAAGGGGTCTCAGCATGG - Intergenic
1172353139 20:34259636-34259658 CTGGGGCAGGAGACTGAGGCAGG + Intronic
1172446375 20:34995597-34995619 GTGGGGAAGGGCCCTGAGCCAGG + Intronic
1172502334 20:35436375-35436397 GTGGGGGAGGGGTCAGAGGGTGG - Intronic
1172658229 20:36549669-36549691 GTAGGGAAGGGGACTGAGAGGGG - Exonic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1172998887 20:39091509-39091531 GTTGGGAAGGGGCTTGAGGCAGG + Intergenic
1173020417 20:39262922-39262944 GTTGGGAAGGGTAGTGGGGAGGG + Intergenic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173870934 20:46341718-46341740 GTGGGGATGGGGGCTGAGGGAGG + Intergenic
1173876632 20:46376421-46376443 GTGGGGAGGGAGAGTCAGGAGGG - Intronic
1173882622 20:46428238-46428260 GAGGGGTAGGGGAGTGAGGATGG + Intronic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1174156463 20:48518702-48518724 GGGAGGGAGGGGACTGGGGATGG - Intergenic
1174196383 20:48775539-48775561 CTGGGAAAGGGGACTCAGGCAGG + Intronic
1174287031 20:49481100-49481122 GGGCTGTAGGGGACTGAGGAAGG - Intronic
1174507355 20:51024996-51025018 GTGGGGGAGGGGCCTGAGTGGGG + Intergenic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1175147821 20:56910169-56910191 GTGGGGAAGGGGACAGAAATAGG - Intergenic
1175237588 20:57525239-57525261 GGGGGGAAGGGGAGTAGGGAGGG + Intronic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1175527318 20:59644445-59644467 GTGGGGGAGGCGAATGAGGGAGG - Intronic
1175570236 20:60012585-60012607 GCGAGGAAGGGGAGTGTGGAGGG + Exonic
1175795110 20:61766191-61766213 GTGGCGAGGGAGACTGAGGGTGG - Intronic
1175872023 20:62213343-62213365 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872188 20:62213737-62213759 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915111 20:62422570-62422592 GTGGGGATGGCGACTGGGGTGGG + Intronic
1175915120 20:62422588-62422610 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915149 20:62422642-62422664 GTGGGGATGGGGACCGGGGTGGG + Intronic
1175915159 20:62422660-62422682 GTGGGGATGGGGACCGGGGTGGG + Intronic
1175916146 20:62426949-62426971 GTGGGGGAGGGGGTTGAGCAAGG + Intronic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1176304111 21:5114424-5114446 GTGGAGCAGGGGACTGAGTGTGG + Intergenic
1176383195 21:6123972-6123994 CTGGGGAAGGGTCCTGAGGAGGG - Intergenic
1176513660 21:7767369-7767391 GGGGGGAAGGGGGCAGGGGAGGG - Intronic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1176916837 21:14635952-14635974 GTGGGGTGGGGGACTGGGGGAGG - Intronic
1177024240 21:15902459-15902481 GTTGGGAAGGGTATTAAGGAAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178321637 21:31610440-31610462 GAGGGACAGGGGACCGAGGAGGG + Intergenic
1178340506 21:31782133-31782155 GTGGGGTAGAGGACAGAGCATGG - Intergenic
1178647773 21:34397893-34397915 GGGGGGAAGGGGGCAGGGGAGGG - Intronic
1178933056 21:36836206-36836228 GTGGGAGAGGTGACTGTGGAAGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179165713 21:38933722-38933744 GGGTGGAGGGGGGCTGAGGAAGG - Intergenic
1179382838 21:40915293-40915315 GTGAGTCAGTGGACTGAGGAGGG + Intergenic
1179673208 21:42964210-42964232 GTGGGGTAGGGGAGAGAAGAGGG - Intergenic
1179740272 21:43414267-43414289 CTGGGGAAGGGTCCTGAGGAGGG + Intergenic
1179840036 21:44066299-44066321 GGGGCGACGGGGGCTGAGGAGGG + Intronic
1179852945 21:44147606-44147628 GTGGAGCAGGGGACTGAGTGTGG - Intergenic
1179890738 21:44333971-44333993 ATGGGGAGGGGGGCTCAGGACGG - Intronic
1179906569 21:44426031-44426053 GTGGTGGAGGGGCCTGAGGGGGG + Intronic
1179952672 21:44718896-44718918 ATTGGGATGGGGACAGAGGAAGG - Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180182264 21:46123291-46123313 TTGGGGGAGGGGACTCTGGAGGG - Intronic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180724548 22:17936424-17936446 GTGGGGTAGGGGACTAGGGGAGG + Intronic
1180786303 22:18549678-18549700 GAGGGGATGGGTACTGGGGAGGG - Intergenic
1180790705 22:18574094-18574116 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181006439 22:20016029-20016051 GTGGGGAGGGGGACCCAGGCCGG + Intronic
1181231032 22:21421220-21421242 CTGGGGGAGGGCTCTGAGGAGGG + Intronic
1181247616 22:21513648-21513670 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1181439084 22:22926643-22926665 GTGGGGAAGGGGACTGGAGTGGG - Intergenic
1181459432 22:23077614-23077636 GGGGGCAAGGTGACTAAGGAGGG + Intronic
1181617018 22:24061868-24061890 GGGGGGTAGGGGGCTGTGGAAGG - Intronic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182321312 22:29480051-29480073 GCGGGGCAGGGGACCGAGGAGGG - Intergenic
1182411590 22:30191461-30191483 GAAGGGGAGGGGACTGAGAAAGG - Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182541397 22:31044639-31044661 GTGGGGGAGGGGGCGGAGGCTGG - Intergenic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182870226 22:33639919-33639941 GAGGGCAAAGGGACTGATGAGGG + Intronic
1183028118 22:35081608-35081630 GTGGGGAAGGGAACTGGGCAGGG + Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1183269229 22:36850287-36850309 CTGGGGAAGGTGGCTGAGGTTGG + Intergenic
1183273392 22:36875949-36875971 GGGGGAAAGGGGAATGAGGCTGG - Exonic
1183346589 22:37311589-37311611 GTGGGGAGAGGGCCTGAGGCTGG + Intronic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183660613 22:39218805-39218827 GTGGGGTTGGGGGCTGAGGGAGG + Intergenic
1183946675 22:41330174-41330196 GTGGGGAAGGTGGGTGAGGGTGG + Intronic
1184021187 22:41822571-41822593 GTGGGGAAGGGAACAGGGAAAGG + Intronic
1184194293 22:42916407-42916429 GTGGGGATGGGGGGTGGGGAAGG + Intronic
1184332063 22:43833524-43833546 GAGGAGGAGGGGTCTGAGGAGGG - Intronic
1184421342 22:44384499-44384521 GTGGGAAAGGGGTGTGGGGAGGG + Intergenic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184620199 22:45671516-45671538 GGGGGTAAGGGGCCTGTGGAGGG - Intergenic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185025576 22:48408738-48408760 GTGGTGAAGGGATGTGAGGATGG - Intergenic
1185094963 22:48801060-48801082 GTTGGGCCAGGGACTGAGGAGGG + Intronic
1185224313 22:49644200-49644222 GTGGGTGTGGGGACGGAGGATGG + Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185326586 22:50228628-50228650 GTGGAGAAGGGGTCAGAGCAGGG - Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950727061 3:14923416-14923438 GTGTGTAAGGGGACAGAGGCAGG + Intronic
950853316 3:16083147-16083169 GTGGTGGAGGGGAGTGAAGATGG + Intergenic
951123558 3:18957946-18957968 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
951179166 3:19638643-19638665 GTGGGGTGGGGGAGGGAGGAGGG + Intergenic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
951909064 3:27730462-27730484 GTGGGGAGGAGGACAAAGGAGGG - Intergenic
952352279 3:32551862-32551884 GAAGGGCAGAGGACTGAGGAAGG - Intronic
952532657 3:34278165-34278187 GCTGGGAAGGGTAGTGAGGAGGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
953330620 3:42050164-42050186 TTGGGGAAGGGAACTGAGGGTGG + Intronic
953476419 3:43209476-43209498 TGGGGAAAGGGGACTGAGAAGGG + Intergenic
954361596 3:50125362-50125384 GAGGGGCAGGGGACTCAGGGAGG + Intergenic
954366850 3:50151021-50151043 GTTGGGAAGGGGGCTGGAGAGGG - Intergenic
954374144 3:50185366-50185388 GTGGGGGAAGGGGCTGAGGCTGG + Intronic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954411605 3:50373600-50373622 GTGGGGAGTGGGACTGAAGGGGG + Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
954748291 3:52799342-52799364 GTGGGGAGAGGGACGGAGGCCGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955826736 3:62955317-62955339 GTGGGGAAGGGTGTAGAGGATGG + Intergenic
955923756 3:63985682-63985704 GTGAGGAGGGGCAGTGAGGATGG - Intronic
956125360 3:66005851-66005873 GAGGGAAAGGGCACTTAGGAAGG + Intronic
956701796 3:71965286-71965308 GTGGGGAGGGGGCTGGAGGATGG + Intergenic
956796282 3:72721759-72721781 ATGGGGCTGGGGACCGAGGAAGG - Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957396915 3:79652316-79652338 GTGTGGAAGAGGTCTGAGAATGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958601045 3:96297851-96297873 GTGTGGAAGGGGACCCAGGTGGG - Intergenic
958721009 3:97843443-97843465 GTGGGGAAAGGCTCTGAGAAGGG + Intronic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959398179 3:105868356-105868378 GCCGGGAAGGGGCCTGAGCAGGG - Intronic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960787021 3:121384822-121384844 ATGGGGACGGGGACAGAGAAGGG - Intronic
960825197 3:121775473-121775495 GTGGGGTAGGGAACTAAGGGAGG + Intronic
960947005 3:122973808-122973830 GTGGGGAAGGGCAGAGAGGGAGG + Intronic
960991092 3:123311835-123311857 GTGGGGGAGGGGCCGGTGGATGG - Intronic
961008253 3:123419418-123419440 GTGGGTATGGGGCCTGAGGTGGG - Intronic
961118554 3:124352863-124352885 GTGGGGTAGGGGGCTGAGGGAGG + Intronic
961393437 3:126570194-126570216 GTGGGGTTGGGCACTGAGAAGGG - Intergenic
961594729 3:128007102-128007124 GTGGGGAAGGGCCCCGAGAAGGG - Intergenic
961602742 3:128073594-128073616 TTGGGGCAGGGGAGTGAGGTGGG - Intronic
961622146 3:128232567-128232589 GGGGGGAAGGGGACTGAGGCGGG + Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961740777 3:129032005-129032027 ACGGGGATGGGGACTGAGGTTGG + Intronic
962415027 3:135174096-135174118 GTGGGGAAGGGGCTGGAGGTTGG - Intronic
962426225 3:135271428-135271450 GTGGGGAAAGGCAATGAGGCTGG - Intergenic
962656527 3:137549626-137549648 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
962835248 3:139183871-139183893 GTGGGGAAGGTGTTTAAGGAAGG + Intronic
963067247 3:141273507-141273529 GTGGGGAAGGGTGGTGGGGAGGG + Intronic
963084171 3:141421682-141421704 GTGGGGTGAGGGGCTGAGGACGG - Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
964612223 3:158627053-158627075 TTGGGGAGGGGGACTTAGGCTGG + Intergenic
964998873 3:162926285-162926307 GTGGGGTGGGGGACAGGGGAGGG + Intergenic
965147895 3:164929330-164929352 GTGGGGAAGGGGATAGAGAGAGG - Intergenic
965193465 3:165562043-165562065 GAGGGGTAGGGGAGTGGGGATGG - Intergenic
965475587 3:169150897-169150919 GGAAGGAAGGGGCCTGAGGAGGG - Intronic
965800695 3:172490963-172490985 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
966129792 3:176624555-176624577 GTGGAGAGTGGTACTGAGGATGG + Intergenic
966133173 3:176667526-176667548 GTTGGGAAGGGTAGTGGGGAGGG - Intergenic
966429682 3:179818572-179818594 GGGGGGTAGGGAACTGGGGATGG - Intronic
966524929 3:180910384-180910406 GTGGGGCAGGGGGTTGAGGCGGG + Intronic
966562832 3:181342601-181342623 GTGGGGCAAGGTACTGAGGTGGG - Intergenic
966781007 3:183584193-183584215 GTGGGACAAGGGACTCAGGAAGG - Intergenic
966859839 3:184224558-184224580 GTGAGTAAGTGGACTGAGTAGGG - Intronic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
966914046 3:184575285-184575307 GCAGGGATGGGGGCTGAGGACGG - Intronic
967419028 3:189253186-189253208 GGGGGTGAGGGGCCTGAGGAGGG - Intronic
967452771 3:189645647-189645669 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
967477053 3:189934219-189934241 GTGGTGAAGGGGAGTGATCAGGG - Intergenic
967565440 3:190965830-190965852 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
967757453 3:193185724-193185746 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
967767478 3:193296959-193296981 GTTGGGAAGGGCAAGGAGGAAGG + Intronic
967847929 3:194058565-194058587 GTGGGGAGGGGGACGGGGGCAGG + Intergenic
967880660 3:194298993-194299015 GTTGGGGTGGGCACTGAGGAAGG + Intergenic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968523470 4:1045004-1045026 ATGGGGCAGGGGTCTGAGGCTGG - Intergenic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968835837 4:2963722-2963744 CGGGGGCAGGGCACTGAGGAGGG + Exonic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
968921402 4:3523969-3523991 GCGGGGGAGGGGATTGGGGAAGG + Intronic
968923844 4:3536689-3536711 TGGGGGAAGGGGTCTGAGAAGGG - Intergenic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969297098 4:6276627-6276649 GAGGGGAAGGGAGCTGGGGAGGG - Intronic
969307151 4:6332356-6332378 GTGAGGAGGGGGCCTGAGGGAGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969333407 4:6492963-6492985 GTGAGGAGGGAGACTGGGGAGGG - Intronic
969582964 4:8076489-8076511 GTAGGGAGGGGCACTGAGGAAGG - Intronic
970187286 4:13470907-13470929 GGGGGCAAAGGGACTGAAGAGGG + Intronic
970903698 4:21190505-21190527 GTGGGGGGGGGCACTGAGGGTGG + Intronic
971223005 4:24726090-24726112 GTGGGTAAGGGTACAAAGGATGG - Intergenic
971630572 4:28987937-28987959 GCATGGAAGGGGACTGAGGCAGG + Intergenic
972687371 4:41363698-41363720 GAGGGGAAGGGGGCTGAAGTGGG - Intronic
972718797 4:41675434-41675456 GTGGGGAAGTTGACGGGGGATGG - Intronic
972739910 4:41879256-41879278 GCGGGGAGGGGGACAGAGGCAGG + Intergenic
973088053 4:46093454-46093476 GTGAGGTAGGGGAGTGGGGATGG + Intronic
973668107 4:53183502-53183524 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
973726867 4:53785800-53785822 GAGGGGAAGGGTTCTGAGGGGGG - Intronic
973774519 4:54231881-54231903 CTCGGGACGCGGACTGAGGAGGG + Intronic
973951974 4:56025044-56025066 GTGGGGGAGGATACTGAGGCAGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974992731 4:69114686-69114708 GTGTGGAAGGGGACTGGAGCGGG + Intronic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975075768 4:70207357-70207379 GTGGGGTAGGGGGCTGAGGGAGG - Intergenic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975756024 4:77571738-77571760 GTGTGGAAGGGGACTGGAGCGGG - Intronic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976244070 4:82990050-82990072 GTGGGCAAGGGCAGTGGGGATGG - Intronic
977051687 4:92136186-92136208 GTGGGGAAGGGGATGTAGAAAGG + Intergenic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978240154 4:106505605-106505627 GTGGGGAAGGCCACAGAGCAAGG - Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
981088743 4:140710733-140710755 GTGGGGGGGTGGTCTGAGGAAGG + Intronic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
981414836 4:144480694-144480716 GCTGGGAAGGGTAGTGAGGAGGG + Intergenic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981659087 4:147145454-147145476 GTGGGAAAGGGCAATGAAGAAGG + Intergenic
981718943 4:147779457-147779479 ATGGGGAAGGGTCCTGAGGGGGG + Intronic
982090467 4:151876017-151876039 GTGGGGGAGTGGAGTGAGGGGGG - Intergenic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
982826826 4:160012504-160012526 GTGGGGTGGGGGAGTGGGGATGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983183177 4:164672097-164672119 GTGGGGTAGGGGAGAGGGGAGGG + Intergenic
983393467 4:167163576-167163598 GTTGGGAAGGGTAGTGGGGAGGG - Intronic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983614422 4:169686172-169686194 GTGGGGTCGGGGAGTGGGGAGGG + Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
985493525 5:192444-192466 CTTGGGGAGGGGACTGAGGGCGG + Intronic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
985771942 5:1817364-1817386 GTGGGGAGGGAGGCTGAGGCAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986296616 5:6444685-6444707 GTGGGGAAGGGGAGTGGTTAGGG - Intergenic
986296634 5:6444760-6444782 GTGGGGAAGGGGAGTGGTTAGGG - Intergenic
986517243 5:8576438-8576460 GAGGGGAAGGTGATTGAGGGAGG - Intergenic
986773477 5:10994293-10994315 GCGGGGGCGGGGACGGAGGAAGG + Intronic
986867431 5:12006478-12006500 GAGGGGGAAGGGAGTGAGGAAGG - Intergenic
987475508 5:18387599-18387621 GTGGGTAGGGGGAGTGGGGATGG - Intergenic
988364471 5:30278122-30278144 GTGGGGATGGGGGTAGAGGAGGG + Intergenic
989027728 5:37086623-37086645 GTGGGGAGGGGAATGGAGGAAGG + Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989401683 5:41014436-41014458 GTGGGGTAGGGGGGTGCGGAGGG + Intronic
989785181 5:45318413-45318435 GTGGGGTGGGGGAGGGAGGAAGG + Intronic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
990589652 5:57249764-57249786 GAGGGGAAGGGGAGAGGGGAAGG - Intronic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991472433 5:66983653-66983675 GAGGGGGAGGGGAATGGGGAGGG + Intronic
991680524 5:69134895-69134917 GAGGGGAGGGGGAATGAGGCAGG + Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992261502 5:74975148-74975170 GTAGGGAAGGGGAGGGAGGTGGG + Intergenic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992804096 5:80320010-80320032 GTGGGAAAGGGGACCAAGGCTGG - Exonic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
992972741 5:82079507-82079529 GTGGGGTGGGGGATTGGGGAGGG - Intronic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994100303 5:95884084-95884106 GTGGGAGAAGGGACTGGGGAGGG + Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994399459 5:99260952-99260974 GTTGGGAAGGGTACTGGGGTTGG + Intergenic
995650132 5:114361240-114361262 GTGGGGGCGGGGCCGGAGGAGGG - Intronic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
995838481 5:116421435-116421457 TTGGGGAGGGTGACTGGGGAAGG + Intergenic
995873084 5:116762797-116762819 ATTGGGAAGAGGACTGAGAAAGG + Intergenic
996274200 5:121644815-121644837 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
996277230 5:121681598-121681620 GCGGGGAGGGGGCCCGAGGAAGG - Intergenic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997655126 5:135548772-135548794 GTGGGGAAGGGCCCTGACTATGG + Intergenic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
998039556 5:138943825-138943847 GTGGGGAAGGCCTCTGAGGAGGG - Intergenic
998094681 5:139390528-139390550 GCGTGGAAGGGCACTGTGGAGGG + Intergenic
998129778 5:139645860-139645882 TTGGGGAAGGGGGCTGTGGTGGG + Intergenic
998370112 5:141655477-141655499 GTGGGGAATGGGGGTGAAGAAGG + Intronic
998712868 5:144847099-144847121 GTGTGGAAGGGGACTGGAGTGGG + Intergenic
999113196 5:149139968-149139990 GTGGGATAGGGGACTGGGGGAGG - Intergenic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999221213 5:149979336-149979358 GTGGGGAGGGAGAGTGAAGATGG + Intronic
999330824 5:150672281-150672303 GTGGGGTTGGGGGCTGAGGGTGG + Intronic
999448142 5:151657934-151657956 TAAGGGAAGGGGAGTGAGGAAGG - Intergenic
999791610 5:154945130-154945152 GTGGGGATGGGGAGCAAGGATGG + Intronic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1000903433 5:166935749-166935771 GTGTGGAAGGGGACTGGAGCTGG + Intergenic
1001101852 5:168820910-168820932 GCGGGGAAGAGGAGAGAGGAAGG - Intronic
1001180131 5:169512679-169512701 GTGGGACAGGAAACTGAGGAGGG - Intergenic
1001400685 5:171444668-171444690 GTGGTGAAGGGCACTGACCATGG + Intronic
1001831576 5:174793759-174793781 CTGGGGTAGGGGACTGCGGAGGG - Intergenic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002047325 5:176549397-176549419 GTGGCGAAGGGGACACAGGTAGG + Intronic
1002053576 5:176585725-176585747 GCAGGGAAGGGGACTGAGCATGG + Intronic
1002304191 5:178273786-178273808 GTGGGTATGGTCACTGAGGAGGG + Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002461407 5:179375787-179375809 GCGGGGGAGGGGAATGAGGTAGG + Intergenic
1002493893 5:179599071-179599093 GTGTGCAAGGGGCCTGGGGAGGG + Intronic
1002516660 5:179764058-179764080 GATGGGAAGGGGACAGAAGACGG - Intronic
1002520954 5:179793098-179793120 GTGGGGAGGGGGACTACGGCGGG - Intronic
1002633696 5:180596810-180596832 GGGAGGACGGGGGCTGAGGAGGG - Intergenic
1002633892 5:180597785-180597807 GTGAGGAAGGAGGCTGAGGAAGG + Intergenic
1003158653 6:3617602-3617624 GTGTGGAGGGAGACTGAGAAGGG + Intergenic
1003378668 6:5602805-5602827 GTGCCAAAAGGGACTGAGGAGGG - Intronic
1003592103 6:7445178-7445200 GTGGGGAAGGGGCCTTTGAAGGG + Intergenic
1003854988 6:10264372-10264394 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004512578 6:16294863-16294885 GTGGGGATGGGGTCAGAGGGTGG + Intronic
1005169665 6:22968515-22968537 GCGGGGAGGAGGACTGAGCAAGG - Intergenic
1005952737 6:30643519-30643541 GCGGGGAAGGGAGCTGTGGAAGG - Intronic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006130891 6:31868937-31868959 GTGGGGAGGGAAACTGAGGCTGG - Intronic
1006133883 6:31884247-31884269 GTGGGGAGGGGGCCTGTGGGTGG + Intronic
1006296330 6:33171675-33171697 TTGGGGAGGGGTACTGGGGAGGG - Intronic
1006510233 6:34517476-34517498 TTGGGGGAGGGAACTGGGGAGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006644013 6:35503896-35503918 GTGTGGAAGGGGCCTGGGGCAGG - Intronic
1006794464 6:36722730-36722752 GTGGGTAAGGGCATTGGGGAGGG + Exonic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1006806705 6:36793732-36793754 GTGGGGAAGGGGCCTCCGGCGGG - Intronic
1006820596 6:36891135-36891157 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007298199 6:40844944-40844966 GTGAGGAAGGGTACAGTGGAAGG + Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1008013428 6:46491599-46491621 GGTGGGTAGGGGACTGGGGAGGG - Intronic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009714214 6:67367407-67367429 GCAGGGGTGGGGACTGAGGATGG - Intergenic
1010390778 6:75334726-75334748 GTGGAGTAGGGGGCTGAGCAAGG - Intronic
1010467489 6:76186255-76186277 GTGGGGTGGGGGGCTGGGGAGGG - Intergenic
1010501100 6:76601342-76601364 GAGGGGTAGGGGGCTGGGGAGGG + Intergenic
1010513450 6:76745791-76745813 GTGGGGTGGGGGACGGGGGAGGG - Intergenic
1010696273 6:78977375-78977397 GTGGGGTGGGGGACGGGGGAGGG + Intronic
1010773039 6:79854423-79854445 GTGGGGCAGGGAGGTGAGGATGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1010954454 6:82074063-82074085 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1010981504 6:82375156-82375178 GTGTGGCATGGGACTGAGGAGGG + Intergenic
1011380525 6:86737869-86737891 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1011720960 6:90156157-90156179 GTGGGGAGGGAAACTGAGGTAGG + Intronic
1011959559 6:93070248-93070270 GTGGGGAAGGGGAAAGGGAAAGG + Intergenic
1012390002 6:98727797-98727819 GTTGGTAAGGGGAGTGAGGCGGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013833517 6:114303297-114303319 GGGGGTGGGGGGACTGAGGAAGG - Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014403928 6:121024856-121024878 GTGGGGTGGGGGAATGGGGAAGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014948015 6:127519031-127519053 GCGGGGAGGGGGACGGGGGACGG + Exonic
1015074148 6:129134553-129134575 GGGGGGATGGGGAGTGGGGATGG + Intronic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1016437541 6:144052746-144052768 GTGGGGGAGGGGGTTGTGGAGGG + Intronic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1016887438 6:148971067-148971089 GGGGGAGAGGGGACTGTGGAGGG + Intronic
1016989388 6:149918837-149918859 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1016998638 6:149979255-149979277 GTGAGGAAGAGGAGTCAGGAGGG - Intergenic
1017011253 6:150065172-150065194 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017300794 6:152855482-152855504 GTGAGGGAGAGGAGTGAGGATGG + Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017614224 6:156227661-156227683 GTGGGGAGGGGAAGTGGGGATGG + Intergenic
1017646224 6:156542147-156542169 GTGGTCAAGGGGGCTGGGGATGG - Intergenic
1017861480 6:158402237-158402259 GTGGGGAAGGGGTGGGAGTAGGG - Intronic
1018075499 6:160208870-160208892 GTGGGGTGGGGGGCTGAGGGAGG - Intronic
1018178548 6:161200048-161200070 GAAAGGAAGGGCACTGAGGAGGG + Intronic
1018188412 6:161287785-161287807 GCAGGGCAGGGGTCTGAGGATGG + Intergenic
1018308570 6:162484443-162484465 CGGGGGAAGGGGACTCAGGCTGG + Intronic
1018371225 6:163170176-163170198 GCGGGGAAGGGAACTGTTGAGGG + Intronic
1018612536 6:165660310-165660332 GTGGGGAAGGGGTGTGGAGATGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019604534 7:1901874-1901896 GTGGAGGAGGGGCCCGAGGAGGG - Intronic
1020014910 7:4825202-4825224 GAGGGGAAGGGCACTCAGCAGGG + Intronic
1020049521 7:5072528-5072550 GCGAGGAAGGGGACTGGGGGCGG + Intronic
1020365557 7:7377455-7377477 CTGGGGCAGGAAACTGAGGATGG + Intronic
1020485373 7:8714413-8714435 GTGGGGAAGAGCACTAAGCAGGG - Intronic
1020558782 7:9702491-9702513 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021510568 7:21428273-21428295 GCGGCGAAGGAGACTGAGGGGGG - Intronic
1021520581 7:21536046-21536068 GTGTGGAAGGGGACTCAAGCGGG + Intergenic
1021678847 7:23108547-23108569 GTGGGGTTGGTGACTGAGAAGGG - Intronic
1021760878 7:23902408-23902430 GTGGGGGAGGAGACAGAGGGAGG + Intergenic
1021820384 7:24492289-24492311 GTGGGGCAGGGGGCACAGGATGG + Intergenic
1022181414 7:27924021-27924043 ATGGGGACGGGGACTGAAAATGG + Intronic
1022431690 7:30329439-30329461 GCTGGGAAGGGTACTGGGGAAGG - Intronic
1022494574 7:30844756-30844778 GAGGGGAAGGGTGCTGAAGAGGG + Intronic
1022821085 7:33961612-33961634 GTGTGGGAGGGCACTGAAGAAGG + Intronic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1023184270 7:37516644-37516666 GTGGGGAAGGCTTCTCAGGAAGG - Intergenic
1023389340 7:39693417-39693439 GTGGGGTGGGGGACTGGGGGAGG + Intronic
1023608830 7:41954407-41954429 GAGGGGAAGGGGGCTGGAGATGG + Intergenic
1023705083 7:42932536-42932558 GTGGGAGAGGGGGCTGATGACGG + Intronic
1023808280 7:43890656-43890678 GTGGGGAAGTGCCCAGAGGAGGG - Intronic
1023834698 7:44061218-44061240 GCGGGGAAGGGTCCTGAGCAGGG + Exonic
1023863123 7:44227158-44227180 GAGGTGCAGGGGACAGAGGAGGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1024127096 7:46310348-46310370 GTTGGGAAGGGGACTTACTAAGG - Intergenic
1024177340 7:46854450-46854472 GTTGTGTAGGGGGCTGAGGAGGG + Intergenic
1024291434 7:47807412-47807434 GGGGAGAAGGGGCCTGAAGATGG + Intronic
1024874740 7:54009048-54009070 CTGGGGCAGGGCACAGAGGATGG - Intergenic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1026291954 7:69015242-69015264 GGGGGGAAGGGAACTTAGCAAGG - Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026361443 7:69604559-69604581 GTGGGGAATGGGACCTAGAAGGG + Intronic
1026736747 7:72953877-72953899 GTGGGGAAAGGGTCTAAGGCTGG - Intergenic
1026945724 7:74314802-74314824 GTGGGGAAGAGGCCTGGGGGTGG + Intronic
1027106987 7:75411186-75411208 GTGGGGAAAGGGTCTAAGGCTGG + Intergenic
1027226581 7:76247556-76247578 GTGGAGGAGGGTACGGAGGAGGG + Intronic
1027230221 7:76267954-76267976 ATGGGGGAGGGGGCTGAGGGAGG - Intronic
1027435129 7:78156295-78156317 GTGGGGAAGGGGACAGGGAGGGG + Intronic
1027915143 7:84308610-84308632 GTCGGGAAGGGGCCAGAGGTTGG + Intronic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1027964409 7:84987579-84987601 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1028211852 7:88083337-88083359 GTGGGGTGGGGGACTGGGGGAGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028986267 7:97011093-97011115 GGGGGGAAGGGAAGTGAGGGAGG - Intergenic
1029400472 7:100342280-100342302 GTGGGGGAGGGGAGGGAGAATGG - Intronic
1029442608 7:100595371-100595393 GTGCGGAGGGAGGCTGAGGAGGG + Intronic
1029514137 7:101015565-101015587 GTAGGCAAGGAGGCTGAGGAGGG - Intronic
1029538630 7:101170337-101170359 GTGGAGAGGGGTTCTGAGGAGGG - Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030288065 7:107847140-107847162 GTGGGGCAGGGGTGGGAGGATGG + Intergenic
1030616651 7:111744375-111744397 GTGGGGAGGTGGACTGGAGAGGG - Intronic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1031426641 7:121613524-121613546 TTAGGGATGGGGACTGAAGAAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031570241 7:123350222-123350244 GTGAGGAAGAGTAGTGAGGAGGG - Intergenic
1031828570 7:126598055-126598077 GTGGGGGAGGGGAATTAAGAAGG - Intronic
1032107245 7:129043300-129043322 TGGGGGTAGGGGACTGAGGTGGG + Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032428655 7:131842831-131842853 GTGGGGAAGGGGTGGGAGGCTGG - Intergenic
1032478053 7:132225757-132225779 GCAGAGAAGGGAACTGAGGAGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033652556 7:143353788-143353810 GTGGGGGAGGGGACAATGGAGGG + Exonic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034277550 7:149830319-149830341 GTGACTAAGGGGACTGTGGAGGG - Intergenic
1034277613 7:149830556-149830578 GAGGAGGAGGGGACTGTGGAGGG - Intergenic
1034370163 7:150588175-150588197 GTGGGGTGGGGGGCTGAGGGAGG - Intergenic
1034418595 7:150977811-150977833 GTGGGGGAGGGGGCTGAGCGGGG - Intronic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035242391 7:157540717-157540739 CTGGGGAAGGGCCTTGAGGATGG + Exonic
1035264633 7:157684423-157684445 GTGGGGGAGGGGAGTGAGCAGGG + Intronic
1035305448 7:157928714-157928736 GTGGGGAGGGGGGCAGAGGGTGG + Intronic
1035389759 7:158496770-158496792 GTGGGGAAGGGGAGCAGGGAAGG - Intronic
1035463329 7:159060027-159060049 GTGGGTAAGTGAAGTGAGGATGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035538055 8:407241-407263 GTGGGGACGGGGCCTGTGGGAGG + Intronic
1035622371 8:1043614-1043636 GTGGGGAAGGGGGATGAAGGGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036752625 8:11452985-11453007 GTGATGAAGGGGACAGAGGGGGG - Intronic
1036760753 8:11507205-11507227 GTGGGGAAGGAAACTGAAGCGGG + Intronic
1036808774 8:11853143-11853165 GTGGGGTATGGGACAAAGGAGGG + Intronic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037169416 8:15873919-15873941 GAAGGGAAGGGGAGTGGGGAGGG - Intergenic
1037751759 8:21686892-21686914 GTGGGGTAGGGGGATGAGGGTGG - Intergenic
1037753406 8:21696922-21696944 AGAGGGAAGGGGACAGAGGAAGG + Intronic
1037753445 8:21697053-21697075 AGAGGGAAGGGGACCGAGGAGGG + Intronic
1037760401 8:21738141-21738163 GAGGGGGAGGGGGATGAGGAGGG - Intronic
1037893203 8:22635012-22635034 GTGGCCGAGGGGACTGAAGATGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038233647 8:25730482-25730504 GTGGGGAGGGGGGCGGAGGGAGG - Intergenic
1038413339 8:27375255-27375277 CAGGGTAAGGGGACTCAGGAGGG - Intronic
1038544507 8:28414770-28414792 GTGGGGAAGTGGGCAGGGGAGGG - Intronic
1038709026 8:29923464-29923486 GTTGGGATGGGGAGTGAAGAGGG - Intergenic
1038736575 8:30175007-30175029 GGGTGGAAGGTGACTGAGGATGG - Intronic
1038912023 8:31975364-31975386 GTGAGGATGGGAACTGGGGAAGG + Intronic
1039045568 8:33446129-33446151 GTGGGGAAGGGGTCTGAGCTGGG + Intronic
1039059885 8:33565183-33565205 GTGGGAGAGGGGGCAGAGGATGG - Intronic
1039063642 8:33591833-33591855 GAGGGGACGGGGAGTGAGGTTGG - Exonic
1039558721 8:38496017-38496039 GTGGGGCAGGGAACTGTGGCTGG - Intergenic
1039606267 8:38883452-38883474 GTGTCGGAGGGGACTGAGGGTGG + Intergenic
1039609200 8:38905605-38905627 GTGGGGCAGGGGAGTGGTGAGGG - Intronic
1039616263 8:38957081-38957103 GTGGGAGAGGGGCCTGGGGAGGG + Intronic
1039901147 8:41753415-41753437 GAGGGGAAGGGGTCTGGGGGAGG - Intronic
1041330051 8:56714457-56714479 GTGGGGAAGGACAGTGAGGGAGG - Intergenic
1041755139 8:61305325-61305347 GAGGGGAAGGGGAGTGGGAAGGG - Intronic
1042220293 8:66466824-66466846 GAGGGGAAGGGCCCTGAGGCAGG + Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042302715 8:67302981-67303003 GTGGGGCAGGGGGTTGAGGTGGG + Intronic
1042397409 8:68308002-68308024 GTGGGGAGGGTGGGTGAGGAGGG + Intronic
1042486453 8:69351523-69351545 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1042888125 8:73574756-73574778 ATGGGGTAGGGGGCTGAGGGAGG + Intronic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044157848 8:88872188-88872210 GTGGGAAAGAGGACTTTGGATGG - Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1045025579 8:98083627-98083649 GTGAGGAGGGGAAATGAGGAGGG - Intronic
1045258490 8:100550629-100550651 GTGTGGTGGGGGACTGAGCATGG + Intronic
1045365270 8:101470237-101470259 GTGGGGTAGGGGAGAGAGGTGGG - Intergenic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1045888090 8:107123396-107123418 GTGGGGCGGGGGACGGAGGGGGG - Intergenic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1046687039 8:117239281-117239303 GAGGGGAAGGGGGCTGGGAAGGG - Intergenic
1047176189 8:122542811-122542833 GTGGGGAGGGGCACTGAGTACGG - Intergenic
1047329264 8:123871456-123871478 GTGGGGGAGGGGAGTGGGCAGGG - Intronic
1047432424 8:124804572-124804594 GTGAGAAAGGGCACTGAGGCCGG + Intergenic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048296440 8:133218052-133218074 GTGAAGGAGGGGACAGAGGAAGG - Intronic
1048421581 8:134283289-134283311 GTGGGGAATGTGAGTGAGCATGG + Intergenic
1049026036 8:139989581-139989603 GAAAGGAAGGGGAATGAGGAAGG - Intronic
1049161589 8:141101671-141101693 GTGGGGAAGGGCACGGAGAAGGG - Intergenic
1049387995 8:142353933-142353955 GTGGGGAAGAGGACTGAATTTGG - Intronic
1049423069 8:142525333-142525355 GTGGGAAAGGGGACAGAGACAGG + Intronic
1049602595 8:143514880-143514902 GACAGGGAGGGGACTGAGGAGGG - Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050053631 9:1629112-1629134 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1050218444 9:3357583-3357605 GCTGGGAAGGGAAATGAGGAAGG + Intronic
1050248039 9:3712889-3712911 GTGGAAAGGGGCACTGAGGAGGG + Intergenic
1050282653 9:4067082-4067104 GGGCAGAAGGGGACTGTGGAAGG - Intronic
1051125466 9:13798510-13798532 GAGGGGTGGGGGACTGAGGGAGG + Intergenic
1051238924 9:15031190-15031212 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1051295671 9:15593014-15593036 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
1051425893 9:16931046-16931068 GCGGGGAGGGGGTCTGAGGTGGG + Intergenic
1051463934 9:17354773-17354795 GTGTGGAAGGGGACTGGAGCGGG - Intronic
1051536259 9:18161689-18161711 GTGGGGAAGGCTTCTGAGCAGGG + Intergenic
1052212945 9:25929436-25929458 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1052313577 9:27093592-27093614 GTGTGGAAGGGGACCGAAGCGGG - Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052538875 9:29780644-29780666 GTGGGGAGGGAAACTGAGGCAGG - Intergenic
1052568299 9:30186964-30186986 GTGGGGTAGGGGGCTGGGGGAGG + Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1052800600 9:32963805-32963827 GTGGGGTAGGGGGCTGGGGGAGG + Intergenic
1052805823 9:33012402-33012424 ATGTGGAAGGGGACTATGGAAGG - Intronic
1052850177 9:33373425-33373447 GTGAGGAAGGCTAATGAGGAAGG - Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1052954135 9:34239879-34239901 GGGAGGGAGGGGGCTGAGGATGG - Intronic
1053116216 9:35505364-35505386 GTGGGGTCGGGGACTAAGGAAGG - Intronic
1053136073 9:35650889-35650911 GCGGGGTACGGGCCTGAGGAGGG - Exonic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053284455 9:36841354-36841376 GTGGGGAAAGGCACAGAGGCAGG - Intronic
1053313958 9:37036650-37036672 GTGGGCAAGGGGACGGCGGCTGG - Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1053789403 9:41675880-41675902 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1053799557 9:41755713-41755735 GGGGGGAAGGGGTCTGAGAAGGG - Intergenic
1053922806 9:43015089-43015111 GCGGGGAGGGTGACAGAGGAGGG - Intergenic
1054155740 9:61638882-61638904 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054177741 9:61887566-61887588 GAGGGGAACGGTACTGGGGAAGG + Intergenic
1054187967 9:61967774-61967796 TGGGGGAAGGGGTCTGAGAAGGG - Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054475508 9:65569883-65569905 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054650548 9:67620807-67620829 TGGGGGAAGGGGTCTGAGAAGGG + Intergenic
1054659790 9:67693259-67693281 GAGGGGAACGGTACTGGGGAAGG - Intergenic
1054719674 9:68592466-68592488 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1055528198 9:77156401-77156423 GGGGGGTAGGGGACTGGGGAAGG + Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055636522 9:78284181-78284203 GTGTGGAAGGGGACCCAGGTGGG + Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056960114 9:91116049-91116071 ATGGGGAGGGGGACTCAGGCTGG + Intergenic
1056965519 9:91160747-91160769 GGGGGGAAGGGGAGGAAGGATGG - Intergenic
1057274398 9:93668608-93668630 GTGGAGATGGGGACAGAGGTGGG + Intronic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057725867 9:97567764-97567786 GAAGTGAAGGGCACTGAGGAGGG + Intronic
1057763792 9:97898441-97898463 GTGGGGTGGGGGGCTGAGGTAGG - Intergenic
1057919627 9:99086353-99086375 GTGGAGAAGTGTACTGAGGCAGG + Intergenic
1057930314 9:99187340-99187362 CTGGGGAGGGGGACTAGGGATGG + Intergenic
1058365316 9:104201629-104201651 GTGTGGAAGGGGACCGAAGCAGG - Intergenic
1058379437 9:104362297-104362319 GTGTGGAAGGGGACTCAAGCAGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058766083 9:108184086-108184108 GTGGGGAAGAGTAATGAGGCCGG - Intergenic
1058973023 9:110100511-110100533 GTGAGGTAGGGGTCTGAGAAAGG + Intronic
1059042036 9:110825527-110825549 GCTGGGAAGGGTAGTGAGGATGG + Intergenic
1059336902 9:113574787-113574809 GGTGGGAAGGGGAGTGAGGATGG + Intronic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1060227971 9:121807731-121807753 GTGGGGCAAGGGACAGGGGACGG + Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060549890 9:124479912-124479934 GTGGGGAAGGGGACAAAGGTGGG + Intergenic
1060724730 9:125999352-125999374 GGGGGGAAGGGCACTGGGGCTGG + Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060966591 9:127715304-127715326 GTGGGGAAGGGGCGCGAAGAAGG + Intronic
1061189168 9:129071633-129071655 ATGGGAAAGGGGTCTGGGGATGG + Exonic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061434799 9:130554415-130554437 GTTGGGGTGGGGGCTGAGGAAGG + Intergenic
1061515216 9:131085777-131085799 GTCGGGAAGGGGCCCGCGGAAGG - Intronic
1061883655 9:133580095-133580117 GCGGGGAAGGGGACAGGGCAGGG - Intronic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062099271 9:134719748-134719770 GTTGGTAAGAGGACGGAGGATGG + Intronic
1062294614 9:135817739-135817761 GTGGGGTGGGGGACAGGGGAGGG + Intronic
1062441540 9:136571878-136571900 GGGCAGAAGGGGACAGAGGAAGG - Intergenic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062552421 9:137095703-137095725 GTGGGGAAGGGAGCAGAGGACGG + Intronic
1062566880 9:137167541-137167563 GCGGGGGAGGGGGCAGAGGAGGG - Intronic
1203738876 Un_GL000216v2:161748-161770 GTGGGGGATGGGGCTGGGGAGGG + Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1185459843 X:328892-328914 GGGGGGAGGGGGAGAGAGGAGGG - Intergenic
1185459926 X:329070-329092 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185459935 X:329090-329112 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185485936 X:481820-481842 GGGAGGAAGGAGACGGAGGAAGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185621287 X:1452708-1452730 GCGGGGCAGGGGACCGGGGACGG - Intronic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186064641 X:5749006-5749028 CTGGGGAGGGGCTCTGAGGAAGG + Intergenic
1186621108 X:11240949-11240971 GTGGGGTGGGGGGCTGAGGCAGG + Intronic
1186747212 X:12582541-12582563 GAAGGGAAGGAGACTGAGCAAGG + Intronic
1187011057 X:15280197-15280219 GCTGGGAAGGGTAGTGAGGAGGG - Intergenic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1187317122 X:18206660-18206682 GTCGGGAAGGGGTCAGAAGAAGG + Intronic
1187650432 X:21397575-21397597 GATGGGAAGGGGAGTGGGGATGG + Intronic
1187726631 X:22209813-22209835 GTGGGGGAGGAGACAGAGGGAGG - Intronic
1187776790 X:22769169-22769191 GTGGGTACGGGGACAGGGGACGG + Intergenic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1187843833 X:23515559-23515581 GTGGGGAAGTGAATTGGGGAAGG - Intergenic
1187966825 X:24620323-24620345 GAGGGGATGGGGACAGGGGAGGG - Intronic
1188221221 X:27543786-27543808 GTGGAGAATGGGACTGAGACAGG + Intergenic
1188596591 X:31908567-31908589 GTGGGGTGGGGGGCTGGGGAGGG + Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189172807 X:38925733-38925755 GTGGAGTAGGAGACTGTGGAAGG - Intergenic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189363295 X:40369631-40369653 TTGGGGCAGGGGAGTGGGGAGGG + Intergenic
1189601997 X:42636656-42636678 ATGGGGATGGGAACTGAGGGTGG + Intergenic
1189893066 X:45625780-45625802 GTGGGGAGGGGGGCTGGGGGAGG - Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190664827 X:52687166-52687188 GGGAGGAAGGGGACAGGGGAGGG + Intronic
1190674595 X:52771253-52771275 GGGAGGAAGGGGACAGGGGAGGG - Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191156783 X:57283104-57283126 GATGGGAAGGGGATTGCGGAGGG + Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1191657319 X:63612507-63612529 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191658383 X:63624381-63624403 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192028672 X:67485099-67485121 GTGGGGTAGGGGCCTGGGGGAGG + Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192275795 X:69629707-69629729 GGAGGGAAAGGAACTGAGGAAGG - Intronic
1192360689 X:70436863-70436885 GTAAGGAAGGGGCCTGAGGAGGG + Intergenic
1192384148 X:70648262-70648284 GTGGGATGGGGGACTGGGGAGGG + Intronic
1193008697 X:76650471-76650493 GTGGGGTGGGGGAGTGGGGAAGG - Intergenic
1193151443 X:78128821-78128843 GGTAGGTAGGGGACTGAGGAAGG - Exonic
1193389761 X:80912708-80912730 GTGGGGTAGGGGATAGGGGAGGG + Intergenic
1193432941 X:81434327-81434349 GTGGGGAAGGGGGCTTGGGTTGG - Intergenic
1193612418 X:83648863-83648885 GTGGGGTAGGGGACAGGGGAGGG - Intergenic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195315565 X:103674534-103674556 GTGGGGAGGGGGGTGGAGGAGGG - Intergenic
1195356270 X:104042616-104042638 GGGGGCAAGGGGACTGATGCCGG + Intergenic
1195702635 X:107716535-107716557 GGGGGGGAGGGGACGCAGGAAGG - Intronic
1196056803 X:111364812-111364834 CTTGGGAAGTGGACTGAGGTGGG + Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196350043 X:114718132-114718154 GTGGGCTTGGGGACTGAGGTGGG - Intronic
1196507826 X:116469304-116469326 GCGGGGAAGGGAAGCGAGGAAGG - Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1196761827 X:119207762-119207784 GTGTGGAAGGGGACTGGAGGGGG + Intergenic
1196995760 X:121381897-121381919 CTGGGGTGGGGGGCTGAGGAAGG - Intergenic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197248004 X:124186297-124186319 GTGGGGAAGGGGAAAGATGGAGG - Intronic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197647981 X:129037998-129038020 GTGGGGGTGGGGACGGAGGTGGG + Intergenic
1197887576 X:131234616-131234638 GAGGAGAAGGTGTCTGAGGAGGG - Intergenic
1198075630 X:133190557-133190579 GAGGGGAAGGGGTCCCAGGATGG + Intergenic
1198242031 X:134796602-134796624 GAGAGGAAGGGGGCGGAGGAGGG + Intronic
1198278311 X:135118034-135118056 GCGGGGGAGGGGACACAGGAAGG + Intergenic
1198292651 X:135254482-135254504 GCGGGGGAGGGGACACAGGAAGG - Intronic
1198298548 X:135310677-135310699 GTGGGGGAGGGGACACAGGAAGG - Intronic
1198307774 X:135399941-135399963 GTAGGGGAGGGGACACAGGAGGG - Intergenic
1198626539 X:138582156-138582178 TGGGGGTAGGGGAGTGAGGAGGG - Intergenic
1198677566 X:139146968-139146990 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
1198780708 X:140232699-140232721 GTTGGGAAGGGTACTGGGGAGGG - Intergenic
1199034267 X:143032462-143032484 GTTGGGAGGGGGACTGAGATAGG + Intronic
1199601697 X:149544976-149544998 TAGGGGAAGGGGCTTGAGGAAGG + Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199648678 X:149934507-149934529 TGGGGGAAGGGGCTTGAGGAAGG - Intronic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200017830 X:153179680-153179702 GTGGGGAATGGGAATGCGAATGG - Intronic
1200214920 X:154363914-154363936 GTGGGACAGGGGAGTCAGGATGG + Intronic
1200986175 Y:9304967-9304989 GTGGGGAAGTGGTCTGTGAAAGG - Intergenic
1201227684 Y:11834166-11834188 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1201740901 Y:17323939-17323961 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1202041447 Y:20689623-20689645 GTGGGGTAGGGGACAGGGGGAGG - Intergenic