ID: 1006640727

View in Genome Browser
Species Human (GRCh38)
Location 6:35488334-35488356
Sequence TGTGGTCCAAATTAATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006640727 Original CRISPR TGTGGTCCAAATTAATAGCC TGG (reversed) Intronic
905547102 1:38808531-38808553 TGTGCTCCAAGCCAATAGCCTGG - Intergenic
912874995 1:113348898-113348920 TGGGGTTCAAATCACTAGCCGGG + Intergenic
917220459 1:172723096-172723118 TGAGGTGCAAATTATTAGCAGGG + Intergenic
918676281 1:187290015-187290037 TGTAGTCCAAATTACTTGGCAGG - Intergenic
920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG + Intronic
920576367 1:207063709-207063731 TGTGCTCTTAATTAACAGCCTGG + Intronic
1063531989 10:6842181-6842203 CTTGGTGCAAATTAATTGCCTGG + Intergenic
1064312196 10:14221361-14221383 TGTGGCCTAATTTCATAGCCTGG + Intronic
1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG + Intergenic
1068238572 10:54272400-54272422 TGTAGTCTAAATTAATATTCTGG + Intronic
1070079675 10:73173257-73173279 TGTGGTATAATTTAAAAGCCAGG + Intronic
1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG + Intergenic
1071913811 10:90267760-90267782 TGTGATCCTAATTAGTAGACAGG - Intergenic
1079364906 11:19800607-19800629 TGTGCTCCAACTTGATAGCTTGG + Intronic
1081117278 11:39219102-39219124 TGATCTCCAAATTTATAGCCTGG - Intergenic
1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG + Intergenic
1089299586 11:117490527-117490549 TGGGGTCCAACTTAATAAGCTGG + Intronic
1095526101 12:43127464-43127486 TATGGTCCAAAGAATTAGCCAGG - Intergenic
1097969419 12:65616512-65616534 TGTAGTCCTATTTAATAGCCAGG - Intergenic
1098394660 12:70005393-70005415 TGTGGTCAGAATTAATCACCTGG - Intergenic
1100019637 12:90053444-90053466 TGTGGACTAAATTAACAGACTGG - Intergenic
1100758801 12:97782597-97782619 TGTGGTCCAAATAATGTGCCTGG - Intergenic
1106627738 13:31438049-31438071 TGTGATTCAAATTGATAGCAGGG - Intergenic
1108770086 13:53689191-53689213 TATTGTCCAAATAAATGGCCTGG - Intergenic
1110339519 13:74372809-74372831 TGTAGTCCATTTAAATAGCCAGG + Intergenic
1112345904 13:98589297-98589319 TGTGGTCCCAATCAAAAGCCTGG - Intergenic
1117736648 14:58774907-58774929 TGTGGGCCAAATGAAGAGCATGG + Intergenic
1123800792 15:23818228-23818250 TGCGGGACAAATTAATACCCTGG - Intergenic
1126365997 15:47895088-47895110 TGTGCTATCAATTAATAGCCTGG + Intergenic
1134638153 16:15808369-15808391 TGAGGCACAAAGTAATAGCCGGG + Intronic
1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG + Intergenic
1143722997 17:8826914-8826936 TCTGGTCCAAAGTACGAGCCTGG + Intronic
1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG + Intergenic
1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG + Intergenic
1157509616 18:48261454-48261476 TGTGGTGCAAAATAATGGCTTGG + Intronic
1158686448 18:59619269-59619291 TGTTTTCCAAATTGAAAGCCAGG + Intronic
1163133544 19:15292388-15292410 TGTGGTCCAAATTAGTGCCAAGG - Intronic
1163168374 19:15513125-15513147 TGTGGTCCATATGGAAAGCCTGG - Intronic
1165499032 19:36172898-36172920 TGTGGTCCAAGTTACTAGGGAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168583069 19:57571342-57571364 TGTTGTCCTAATTTATGGCCTGG - Intergenic
927258374 2:21060807-21060829 TATGGTTCAAACTAATAGACAGG - Intergenic
933000468 2:76916222-76916244 TATGGTCCAAAAAATTAGCCGGG + Intronic
938968323 2:136407891-136407913 TGTGGTTCAAATTGAGAGCGTGG - Intergenic
940105139 2:150091042-150091064 AGTGGTCAAAATTAAAAGCTTGG - Intergenic
942762285 2:179413395-179413417 TCTGGTTTAAATTAATAGCACGG + Intergenic
943143552 2:184013836-184013858 TGTGGTCAAAAATAATATCTGGG - Intergenic
946597424 2:221321565-221321587 TGTGCACCAAATAAATACCCAGG - Intergenic
948709625 2:239817722-239817744 TGAGGTCCAGGCTAATAGCCAGG - Intergenic
1170563919 20:17583203-17583225 GGTGCTCCAACTTCATAGCCTGG - Intronic
1171075897 20:22122883-22122905 TATTGTACAAATTAATAGCTTGG + Intergenic
1173446596 20:43124478-43124500 TGGGGTCCAAATGCACAGCCAGG - Intronic
1183812746 22:40270939-40270961 CGTGTTCCACATTAAAAGCCAGG - Intronic
959315805 3:104805134-104805156 AATCGTCCAAATTAACAGCCAGG - Intergenic
959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG + Intronic
962558636 3:136582478-136582500 TATGATCCAAATTTAAAGCCTGG - Intronic
963193176 3:142496349-142496371 TCTGGTCCAAGGTAATGGCCAGG - Exonic
967113717 3:186318174-186318196 TGTGGGCAAAATTTAGAGCCAGG - Intronic
968244132 3:197124696-197124718 TGTGGTCCCAATTATTTGGCAGG - Intronic
969325543 4:6441878-6441900 TGCGGTCAAAATTAAATGCCTGG + Intronic
971107865 4:23546742-23546764 TGTGATCCAAATGAATACTCTGG - Intergenic
972875462 4:43353125-43353147 TTTAGTTCAAATTAATACCCAGG + Intergenic
984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG + Intergenic
984812697 4:183808505-183808527 TTTGTTACAAATTAATAACCAGG - Intergenic
988109972 5:26807557-26807579 TTTGCTCCAAAATAAGAGCCAGG - Intergenic
991193798 5:63907716-63907738 AATAGTCCAAATTAATAGTCTGG + Intergenic
993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG + Intergenic
995152870 5:108870815-108870837 TGTCATCAAAATTATTAGCCTGG - Intronic
995947701 5:117669686-117669708 TGTGGACCACCTTAATAGCAAGG + Intergenic
996883719 5:128330861-128330883 TTTGGCCCACATTTATAGCCTGG - Intronic
998823142 5:146074852-146074874 GGTGTTCCAAATCTATAGCCTGG - Intronic
1000669294 5:164040614-164040636 TGAAGACCAATTTAATAGCCAGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008384585 6:50874181-50874203 TGTGATGTAAATTAATAGCTTGG + Intergenic
1012520878 6:100119871-100119893 TGTGGTCCACAGTAAAAGGCAGG + Intergenic
1020864804 7:13545751-13545773 TGTTCTCCAAATTAACAGCTTGG + Intergenic
1021302001 7:18984683-18984705 AGAAGTCCAAATTAATAGTCTGG + Intronic
1021973755 7:25991104-25991126 TGTAGTCCAAATTAATTGGGAGG + Intergenic
1023494962 7:40785449-40785471 TTTGGACCAAATTAGTAACCAGG + Intronic
1028112420 7:86958006-86958028 TGTGATGCAAATTAATATCCTGG - Intronic
1028698922 7:93753125-93753147 AGTGGTCCAAATCTGTAGCCAGG - Intronic
1038721061 8:30035676-30035698 TGTGGTTCAACTTAATATACTGG + Intergenic
1038900377 8:31835680-31835702 TGTGGTTGAAATGAATAGCAAGG - Intronic
1040619519 8:49074732-49074754 TGTGGTGCAAATTACTAGACAGG + Exonic
1042579710 8:70263359-70263381 TGTGGCCCAAATTTATTGCATGG - Intronic
1045040008 8:98214463-98214485 TCTCGTCAAAAATAATAGCCTGG - Intronic
1049991410 9:995122-995144 TGTTGACCAACTTAACAGCCTGG - Intergenic
1051576093 9:18617252-18617274 TGTTCTCCAAATTATTAGCATGG + Intronic
1053159633 9:35805122-35805144 TGTCTTCCTAATTAGTAGCCAGG + Intronic
1053596095 9:39563264-39563286 TGTGGTCCCAATTACTAGGGTGG + Intergenic
1054570161 9:66801752-66801774 TGTGGTCCCAATTACTAGGGTGG - Intergenic
1058263023 9:102860160-102860182 TGTGGTCATAATTACCAGCCAGG + Intergenic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1058818798 9:108710110-108710132 TCTGGTACAAATACATAGCCTGG - Intergenic
1059549324 9:115212859-115212881 TGTGGACCAAATTGACAGGCTGG - Intronic
1059760608 9:117333930-117333952 TCTTGTCCAGATTAATGGCCTGG + Intronic
1187121743 X:16415363-16415385 TTTGGTCAAAATGAATAGCCTGG + Intergenic
1194154381 X:90369018-90369040 TGTCGTCCAAATTAATATGAAGG + Intergenic
1196540573 X:116902042-116902064 TGTGTTACAAATTAAAAGTCAGG - Intergenic
1197337641 X:125227158-125227180 TGTGGTCCAGTTTAATTGACTGG - Intergenic
1200500738 Y:3945915-3945937 TGTTGTCCAAATTAATATGAAGG + Intergenic