ID: 1006641696

View in Genome Browser
Species Human (GRCh38)
Location 6:35492613-35492635
Sequence AAGCACATTAATAAGCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006641696_1006641701 -8 Left 1006641696 6:35492613-35492635 CCGCCCTGCTTATTAATGTGCTT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1006641701 6:35492628-35492650 ATGTGCTTCCAATTTGGGACTGG 0: 1
1: 0
2: 0
3: 11
4: 93
1006641696_1006641704 25 Left 1006641696 6:35492613-35492635 CCGCCCTGCTTATTAATGTGCTT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1006641704 6:35492661-35492683 CCCCTCCTCCCCACACTACTTGG No data
1006641696_1006641706 26 Left 1006641696 6:35492613-35492635 CCGCCCTGCTTATTAATGTGCTT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1006641706 6:35492662-35492684 CCCTCCTCCCCACACTACTTGGG 0: 1
1: 0
2: 1
3: 20
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006641696 Original CRISPR AAGCACATTAATAAGCAGGG CGG (reversed) Intronic
900723592 1:4198640-4198662 AACCACATTACTAAACAAGGAGG + Intergenic
902455225 1:16529030-16529052 AAACAGATCTATAAGCAGGGCGG + Intergenic
902473917 1:16670348-16670370 AAACAGATCTATAAGCAGGGCGG + Intergenic
902484886 1:16737094-16737116 AAACAGATCTATAAGCAGGGCGG - Intergenic
902496946 1:16878857-16878879 AAACAGATCTATAAGCAGGGCGG - Intronic
906584147 1:46961637-46961659 AGGCACCTTGATAAGCAGGGTGG - Intergenic
907045934 1:51300018-51300040 AAGCACCTTCAACAGCAGGGTGG + Intronic
908909180 1:69052950-69052972 AACCACAATAAGAAGCAGTGAGG - Intergenic
909178163 1:72386298-72386320 AAGCATATTAATAGGAAGAGAGG - Intergenic
910161807 1:84280106-84280128 AAACACATAATTTAGCAGGGTGG - Intergenic
910488441 1:87741932-87741954 AAGAATCTTAATAGGCAGGGAGG - Intergenic
911408119 1:97467039-97467061 AAGCAAATTGATAAGCAAGAAGG + Intronic
912705801 1:111911047-111911069 ATGTACATTAGGAAGCAGGGAGG + Intronic
912865936 1:113256350-113256372 AAGCAAATTAAGAAGATGGGAGG + Intergenic
914383175 1:147139207-147139229 AAGCACATTATAAAGCAGTTTGG - Intergenic
917393752 1:174568749-174568771 AGGAACATTAATAAGAAGAGGGG + Intronic
917426201 1:174917095-174917117 AAGGACACTAATAATCATGGGGG + Intronic
919014317 1:192011081-192011103 AAACACTTTAAAAAGCAGGGAGG + Intergenic
920245455 1:204584515-204584537 AAGCATATTAAAAAGCAATGTGG + Intergenic
920617469 1:207507593-207507615 GATCACATTAATAAGCACTGGGG + Intronic
923430088 1:233911642-233911664 AGGCACATTAATAGGCACGAGGG - Intronic
1063345164 10:5304902-5304924 AAAGACATTAATAACCAGTGGGG - Intergenic
1064439093 10:15337434-15337456 CAGCACTTTAATAAGCAGTAGGG + Intronic
1064439106 10:15337487-15337509 CAGCACTTTAATAAGCAGTAGGG + Intronic
1064439116 10:15337540-15337562 CAGCACTTTAATAAGCAGTAGGG + Intronic
1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG + Intronic
1065797232 10:29318844-29318866 CACCACATTAATTTGCAGGGGGG + Intergenic
1065945923 10:30605489-30605511 CAACACATTAATTTGCAGGGGGG - Intergenic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1071059818 10:81556074-81556096 AAGGACATTAATAAACATAGAGG - Intergenic
1073137814 10:101229482-101229504 AAGCTCATTAATTAGCGGGCCGG + Exonic
1077313056 11:1900989-1901011 AAGGACAGGAATAAGCAAGGAGG + Intergenic
1077969720 11:7176516-7176538 AAGCACATTCATTAGCAATGTGG - Intergenic
1078682318 11:13488277-13488299 AAGCAGATTAATAAGGGGTGTGG + Intergenic
1081857236 11:46311653-46311675 AAGTACATAAATTAGCTGGGTGG - Intronic
1083074856 11:60026106-60026128 AAGAAAATTAATAAGCAATGTGG - Intergenic
1085772545 11:79338215-79338237 AACCACAATAAAAACCAGGGAGG + Intronic
1085980523 11:81718593-81718615 CAGCACATTAATAATCATGATGG + Intergenic
1086882377 11:92164209-92164231 AATCATAGTAATAAGCAGTGAGG - Intergenic
1090354703 11:126132392-126132414 AACCACATTCCTGAGCAGGGTGG - Intergenic
1091111096 11:132968840-132968862 AAGCATATTAATAGGGAAGGAGG - Intronic
1093053376 12:14530786-14530808 ATGCAAATTAATAATCAAGGAGG - Intronic
1095420327 12:42018229-42018251 AACCACATTCATAGGTAGGGTGG - Intergenic
1097815461 12:64068711-64068733 AAAAATATTAATATGCAGGGTGG + Intronic
1099493812 12:83319591-83319613 AAGCACAGAATAAAGCAGGGAGG + Intergenic
1100313861 12:93425151-93425173 AAGCAGATAAAGAAGCAGAGAGG + Intronic
1104522291 12:129486804-129486826 AAGCACATTATTAAGCACATGGG + Intronic
1105027448 12:132858422-132858444 AAACACAAAAATCAGCAGGGTGG + Intronic
1106096756 13:26653012-26653034 AAGCACAGTCATCAGCAGAGTGG - Intronic
1108754735 13:53486230-53486252 GAGCACATTGACATGCAGGGAGG + Intergenic
1112901289 13:104360983-104361005 CAAAACATTAAAAAGCAGGGGGG - Intergenic
1114349157 14:21831129-21831151 AAGCACATTAATAAATACTGGGG - Intergenic
1116175204 14:41460681-41460703 AAGCACATTAATAATCATCTTGG - Intergenic
1116237784 14:42302103-42302125 AATCACATTAATATGCACAGAGG - Intergenic
1116307766 14:43280682-43280704 AAGCACAATAAGAGGCAGAGAGG - Intergenic
1117217573 14:53567815-53567837 ATGCACATTGATATGCTGGGAGG + Intergenic
1118857721 14:69637114-69637136 AAACACATCAAAAAGCTGGGAGG - Intronic
1119892457 14:78193136-78193158 AAGCAAATTCATAACTAGGGGGG + Intergenic
1122753402 14:103956955-103956977 GAGCACACTAATACGCAGGATGG - Intronic
1124897799 15:33793247-33793269 AAACACATTGATGGGCAGGGAGG - Intronic
1126949678 15:53867715-53867737 AATCATATTAATAGGCAGGAAGG - Intergenic
1127887820 15:63218829-63218851 TAACATATTAACAAGCAGGGAGG - Intronic
1134162073 16:11899573-11899595 CAGGACATTAACAAACAGGGGGG + Intronic
1134872985 16:17668421-17668443 CAGCACATTAATAAACAGGCAGG + Intergenic
1136274225 16:29168941-29168963 AAGCACATTTAAAAGCCAGGCGG + Intergenic
1136388877 16:29949178-29949200 AACCACATTAAAAAGCAGTGGGG - Intronic
1140680785 16:77382642-77382664 GATCACATTCATAAGCATGGAGG - Intronic
1142078506 16:88134588-88134610 AAGCACATTTAAAAGCCAGGCGG + Intergenic
1144705057 17:17362724-17362746 AAACCTATGAATAAGCAGGGTGG - Intergenic
1148959452 17:51380962-51380984 AAAGACATAAATAAGCAGGGAGG + Intergenic
1149736788 17:59002682-59002704 AAGCACATTAAAAGGCAGAAAGG + Intronic
1153309827 18:3667234-3667256 AAGTACAAAAATAAGCTGGGTGG - Intronic
1153321549 18:3778793-3778815 AAGCAAATGGATAAGCAGAGGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155507813 18:26549113-26549135 AGGCAGGTTAATGAGCAGGGTGG + Exonic
1157212456 18:45755328-45755350 AACCACATCAAGAAGAAGGGGGG + Intergenic
1158317879 18:56231656-56231678 AAAGACAATAATAAGCAGGAAGG + Intergenic
1159962019 18:74562831-74562853 AAGCACATTCATCAGGAGAGGGG - Intronic
1163290278 19:16374976-16374998 ATGCACATATATAAGCATGGAGG + Intronic
1167213406 19:48148168-48148190 AAGCATGTTCAGAAGCAGGGAGG + Intronic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
925418935 2:3695024-3695046 AATCACATTGCTAAGCAGGGTGG + Intronic
927555401 2:24027640-24027662 AAGCACATTAAAAAGGAAAGAGG + Intronic
929950285 2:46404852-46404874 AAGAACATTAAAAAGAAGAGAGG - Intergenic
933771176 2:85745121-85745143 ATGCACATTTATTAGCAGTGAGG - Intergenic
934888366 2:98044853-98044875 AAGCACATTCACAAGGATGGGGG + Intergenic
937558924 2:123196187-123196209 CAGCACATTTATAAGCATCGCGG + Intergenic
939062566 2:137440740-137440762 AAGCAAATAAGTAAGCAGGTAGG + Intronic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
948299462 2:236891120-236891142 AAACACATAAACAAACAGGGGGG + Intergenic
948391400 2:237613960-237613982 AAGCACATGAACAAACATGGTGG + Intergenic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1169787318 20:9373261-9373283 AAGCACATGAACACACAGGGCGG - Intronic
1170315851 20:15040444-15040466 AAGAACATTAGGAAACAGGGTGG - Intronic
1172829593 20:37822068-37822090 AAGCACAGTAATAATCAGAAAGG - Intronic
1172844327 20:37920674-37920696 ATGGACATGCATAAGCAGGGAGG - Intronic
1174853018 20:54014961-54014983 AAGCAAATTAATATGCAAGCAGG + Intronic
1174947485 20:55004118-55004140 AAGCACATTTCCACGCAGGGTGG - Intergenic
1175794808 20:61765022-61765044 AAGCTGATTAAGAAGCAGGCAGG + Intronic
1179434324 21:41349934-41349956 AGGCACAGTCATAAGCAAGGAGG - Intronic
1179915492 21:44475328-44475350 AAGCACATTAAGAAGCAAAGTGG + Intergenic
1181284806 22:21744125-21744147 AAGCCCATTAGGAAGCAGGCAGG + Intergenic
1183773226 22:39944872-39944894 ATTCACCTTAATAAGCAGGATGG - Intronic
1185246891 22:49777497-49777519 AAGCAGATTAATATGCAGCATGG + Intronic
949397337 3:3629027-3629049 ATGCACATTAATGTGCTGGGAGG - Intergenic
952300793 3:32103057-32103079 GAGCAAATTAATAAGCAAGAAGG + Intergenic
952307270 3:32157350-32157372 AAGCACATCAAAAGGCAGAGGGG - Intronic
953792643 3:45959927-45959949 AAGCACATTAAGATTCAGGTGGG - Intronic
954289492 3:49642235-49642257 AAGCAAAATAGTCAGCAGGGTGG - Intronic
955468975 3:59266339-59266361 AAATAAATTAATAAGAAGGGTGG - Intergenic
957645607 3:82920695-82920717 TAGCACATTAATAAGTAGAGAGG - Intergenic
969266321 4:6066444-6066466 ATGCATATTAAAAAGCAAGGAGG - Intronic
969547367 4:7840014-7840036 AAGCACCTCAATCAGCATGGTGG + Intronic
970396912 4:15677620-15677642 AAACACATTAATGTGCTGGGAGG + Intronic
970599409 4:17629078-17629100 AAATACATTAATTAGCATGGTGG + Exonic
971076653 4:23157267-23157289 AAGCACAGGAATAAACTGGGAGG + Intergenic
973829217 4:54741704-54741726 ATTCACCTTATTAAGCAGGGAGG + Intergenic
974501197 4:62705668-62705690 AAACACATTCATAAACAGAGTGG - Intergenic
975017149 4:69436443-69436465 AAATACATTAATAAAAAGGGTGG + Intergenic
975448314 4:74494179-74494201 AAGAACATGAATAAGCCTGGAGG - Intergenic
975698500 4:77038848-77038870 AGGCACATGAATTGGCAGGGTGG - Intronic
976961353 4:90980053-90980075 AAGGAGATAAATAATCAGGGTGG + Intronic
979770640 4:124520987-124521009 AAGCACATTATTAAGCAAATAGG - Intergenic
980953941 4:139409326-139409348 GATCACATTCATAAGCAGTGGGG + Intronic
981620660 4:146694298-146694320 AAGAAAATTAATGTGCAGGGAGG + Intergenic
982301750 4:153885898-153885920 AAGCACTTTACCAAGCGGGGAGG + Intergenic
983752253 4:171289624-171289646 AAGAAAATGAATAAGCAGGCCGG + Intergenic
984630925 4:182060079-182060101 AAGTACAAAAATCAGCAGGGTGG + Intergenic
987277168 5:16374364-16374386 AAACACATTAATAAGGAGGCTGG - Intergenic
988226711 5:28422370-28422392 AAGCTAATTAAAAACCAGGGTGG - Intergenic
989117673 5:37971381-37971403 AAGAGAATTAATAAGCAGGGAGG + Intergenic
991114517 5:62938693-62938715 AAGGACATTTACAATCAGGGTGG - Intergenic
991661328 5:68953740-68953762 AAGAACATTAATAATAAGGGAGG + Intergenic
995765181 5:115606922-115606944 AACCACATATATAAGCTGGGAGG + Intronic
996690971 5:126339611-126339633 AAGCAGATTAATAATCAGCAAGG - Intergenic
1004772558 6:18800608-18800630 GAGCACAGTAATAAGCAGGAAGG + Intergenic
1006641696 6:35492613-35492635 AAGCACATTAATAAGCAGGGCGG - Intronic
1008854857 6:56071486-56071508 AAGCCCATAATTAAGCAGGTTGG + Intronic
1010038495 6:71354368-71354390 AACCACATTTATAAACAGAGGGG + Intergenic
1010296007 6:74196711-74196733 AAGCACATTTTTAAACTGGGAGG - Intergenic
1013125330 6:107178696-107178718 AAGCACTTTGAGAAGCAGGATGG + Intronic
1013639219 6:112057123-112057145 GAACACATGAAAAAGCAGGGAGG + Intronic
1014701195 6:124690954-124690976 AGGCACATTGAAAAGCTGGGAGG - Intronic
1015219407 6:130787234-130787256 AAGAACATATATGAGCAGGGAGG - Intergenic
1018877359 6:167834827-167834849 AAAAAAATTAACAAGCAGGGTGG + Intronic
1021432382 7:20575431-20575453 AACCACATTACTAAGAAGGCAGG + Intergenic
1022488211 7:30796513-30796535 AAGCATTTTAAAAAGCAGGGTGG + Intronic
1024161121 7:46677677-46677699 AGGCACATTAATAATGAAGGTGG - Intronic
1026212975 7:68323338-68323360 AAGCAACTTAATAAGCAAGAGGG - Intergenic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1029669956 7:102023055-102023077 AAGTACAAAAATTAGCAGGGCGG + Intronic
1032648385 7:133851246-133851268 AAACACATAAATAAGCAAGATGG + Intronic
1037742463 8:21618445-21618467 AGCCACATTAAAAAGCGGGGGGG + Intergenic
1037952139 8:23026092-23026114 AAAGTCATTAATAAGCATGGAGG + Intronic
1037986865 8:23295668-23295690 AAGGACCCTAAAAAGCAGGGAGG + Intronic
1038554675 8:28500274-28500296 AAGCACTTTTATAAGAAGGTAGG + Intronic
1038906796 8:31913481-31913503 AAGAAAATAAATAAGCATGGTGG - Intronic
1040362529 8:46680987-46681009 AAGCACAATAATAATAATGGGGG - Intergenic
1040815286 8:51501775-51501797 TAGCACATTAAAAAGGAGGTAGG + Intronic
1042666407 8:71211435-71211457 AAGTAAATTAATTAGCAGTGTGG + Intronic
1043310755 8:78856620-78856642 AAGCACCTTAATACCCAGGAAGG + Intergenic
1044277367 8:90317753-90317775 AAGCACAAAAAAAAGAAGGGAGG + Intergenic
1044683580 8:94805786-94805808 AAGCATTTTTATAAGCTGGGTGG + Intergenic
1046987328 8:120402810-120402832 AACCCCATTAAAAAGCAGGCAGG + Intronic
1048060791 8:130917492-130917514 ACTCACATTCAAAAGCAGGGTGG + Intronic
1048313079 8:133340964-133340986 TAGCACATTTTTAAGTAGGGTGG - Intergenic
1051079762 9:13280133-13280155 AAGCGCTTTAATCAGAAGGGTGG + Intergenic
1054828269 9:69595377-69595399 AATTCCATTAATAAGCAGGAAGG - Intronic
1057257266 9:93559679-93559701 AAGCAAATCAAGAAGCAGAGAGG - Intronic
1058130183 9:101243071-101243093 AAGCATATTAATAGGCACAGAGG + Intronic
1061325893 9:129864164-129864186 AAGCAGATTAAAAACCAGCGTGG + Intronic
1061476457 9:130870624-130870646 GAGCACATTAAGGAGCAGAGAGG + Intronic
1185547749 X:959137-959159 AGGCACAAAAATAAGCAAGGTGG - Intergenic
1189216608 X:39330600-39330622 AAGTATTTTAAGAAGCAGGGAGG + Intergenic
1191579579 X:62745289-62745311 AAGCACATTCAAAAGCTGGCAGG + Intergenic
1191672588 X:63762290-63762312 AATCACATAGATAAGCAGGTAGG + Intronic
1192057637 X:67788425-67788447 AAGCACAACAAGAAGCAGGTAGG + Intergenic
1194167011 X:90529729-90529751 AAGCTCATTTTTAAGCAGGTTGG - Intergenic
1194615466 X:96096653-96096675 AAGCATATTAGTATGCAGTGTGG + Intergenic