ID: 1006645345

View in Genome Browser
Species Human (GRCh38)
Location 6:35511616-35511638
Sequence GGCCCCAGGGACGCGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006645345_1006645355 4 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645355 6:35511643-35511665 CTCACCGTCCTCCGCGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1006645345_1006645353 2 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645353 6:35511641-35511663 CTCTCACCGTCCTCCGCGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 80
1006645345_1006645362 30 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645362 6:35511669-35511691 GGGCTACCAGAAAGGTTTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 121
1006645345_1006645354 3 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645354 6:35511642-35511664 TCTCACCGTCCTCCGCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1006645345_1006645361 22 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645361 6:35511661-35511683 TGGGGCACGGGCTACCAGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1006645345_1006645357 9 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645357 6:35511648-35511670 CGTCCTCCGCGTCTGGGGCACGG 0: 1
1: 0
2: 0
3: 5
4: 75
1006645345_1006645358 10 Left 1006645345 6:35511616-35511638 CCCTCACCCGCGTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 39
4: 255
Right 1006645358 6:35511649-35511671 GTCCTCCGCGTCTGGGGCACGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006645345 Original CRISPR GGCCCCAGGGACGCGGGTGA GGG (reversed) Intronic
900087377 1:904946-904968 CGCCGCGGGGAGGCGGGTGAGGG + Intergenic
900192752 1:1358424-1358446 GGGCCCTGGGAGGCGGGTGGGGG - Intronic
900482318 1:2905225-2905247 CGCCCCAGGGACGCGGGGACAGG - Intergenic
900658235 1:3770673-3770695 GGCCCCAGGAACGTGGGTGCTGG - Intronic
900965367 1:5953665-5953687 GGCCCCAGGGACCCAGCTCACGG + Intronic
901269750 1:7942587-7942609 GGCTCCAGGCACGCGGGCCAAGG - Intronic
901625827 1:10624490-10624512 GGCCCAAGGGACAAGAGTGAAGG - Intronic
901741374 1:11344182-11344204 GTCCTCAGGGAGGCAGGTGAGGG + Intergenic
901789694 1:11647741-11647763 GGGCCCAGGGATGGAGGTGAGGG - Intergenic
902704184 1:18193084-18193106 GCCCACAGGGAAGGGGGTGAGGG + Intronic
903378707 1:22882508-22882530 GCCCTCAGGGAGGTGGGTGATGG - Intronic
904600156 1:31668545-31668567 GCCCCCAGGGACGCTGCTGGAGG + Intronic
905016434 1:34781730-34781752 GGCCCCGGGGACGCGGGGTCAGG + Exonic
905028944 1:34868786-34868808 GGCCCCAGGGCCGGGGGTGGGGG + Exonic
905643683 1:39609810-39609832 GGCTGCAGGGACCCGGGTGATGG + Intergenic
907802868 1:57789178-57789200 GGCGGCAGGGGCGGGGGTGAAGG - Intronic
908523324 1:64965863-64965885 GGCCCCAGGAAGGAGGCTGAGGG - Intronic
910968634 1:92832193-92832215 GGCCCCTGCGACGCGCGAGACGG - Intronic
912419349 1:109532659-109532681 GTCCCCAGGCATGTGGGTGAGGG + Intergenic
912551686 1:110489305-110489327 GGCCCCAGGGAAGGGGCTGAGGG + Intergenic
915285019 1:154847033-154847055 GGGCTCAGGGAGGGGGGTGAGGG - Intronic
915304630 1:154970396-154970418 GGCCCCAGGGATGAAGCTGATGG + Exonic
915507682 1:156367888-156367910 GGCCCCAGGGATAGGGGTAAGGG - Intergenic
916151488 1:161796452-161796474 GGACCCTGGGATGTGGGTGATGG + Intronic
916361692 1:163977152-163977174 GGGCCAAGGGAAGAGGGTGAAGG - Intergenic
917450837 1:175146120-175146142 GCCCCCAGGGAAGCTGGGGAGGG + Intronic
919919594 1:202160248-202160270 GGCAGCAGGGACGGAGGTGAGGG + Intronic
920215587 1:204359782-204359804 GGCCCCAGGGGCGGGGGAGGAGG - Exonic
922806618 1:228393586-228393608 AGCCCCAGGGAGGCTGTTGACGG - Intergenic
1063368965 10:5508536-5508558 GGACCCAGGGCAGCCGGTGAGGG - Intergenic
1064209770 10:13352208-13352230 GGACTCAGGGACGGGGGAGAGGG - Intergenic
1066402619 10:35090370-35090392 GGCCCCGGAGACGCGGGGGGTGG + Intronic
1066620595 10:37345186-37345208 TGCCACAGGGACGGGGGTGGTGG + Intronic
1070290769 10:75111835-75111857 GGCCCCGGGGAGACGGTTGAGGG + Intronic
1070641602 10:78174282-78174304 TGCACCAGGGAAGCGGATGATGG - Intergenic
1072188587 10:93063325-93063347 GGCCCCAGGGGCGCCGCTGTGGG - Intronic
1072992575 10:100211482-100211504 GGCTGCAGGGATGCGGGTGCGGG - Intronic
1073295205 10:102434669-102434691 GGCCCCTAGGAAGGGGGTGATGG + Intergenic
1073325637 10:102642862-102642884 GGACCCCAGGACGCGGGGGAGGG + Intergenic
1074185563 10:111097338-111097360 GGCCCCAGGGGCTCGGCTCAGGG - Intergenic
1077051530 11:568913-568935 GGCCCGCGGGACGCGGGTGCGGG - Intergenic
1077065675 11:640053-640075 GGCCGCAGGGACCCCGGGGAAGG - Exonic
1077145104 11:1041144-1041166 GGTCCCAGGGATACGGGGGAAGG - Intergenic
1077319493 11:1934927-1934949 GGCCCCAGGGCCGGAGGTGCCGG - Intronic
1077510556 11:2958989-2959011 AGCCCCAGGGATGCTGGCGAGGG + Intronic
1077542155 11:3151825-3151847 CGCCCCAGGGAGGCAGGAGAAGG - Intronic
1078394977 11:10973033-10973055 GGCACCAGGAAGGAGGGTGAGGG + Intergenic
1078823346 11:14905074-14905096 GGCCCCACGACCGCGGGTGTCGG + Intronic
1079035143 11:17014274-17014296 GGACGCGGGGACGCGGGTGGGGG - Intronic
1081595008 11:44453037-44453059 GGCCATAGGGACCCGGGTGTAGG - Intergenic
1081756605 11:45549286-45549308 GGTCCCAGGGACGCCTGTGATGG - Intergenic
1082807484 11:57460183-57460205 GGCGCGAGGGACGCGGCTGGGGG + Intergenic
1083636338 11:64122873-64122895 GGCTCCAGGGCCGGAGGTGAAGG - Intronic
1083861537 11:65422743-65422765 GACCCCGGTGACGCGGCTGAGGG + Intergenic
1088360153 11:108981035-108981057 AGCCACAGGGACACGAGTGAGGG - Intergenic
1088912023 11:114199198-114199220 GGGCCCCGGGACGGGGATGACGG + Intronic
1088912036 11:114199235-114199257 GGGCCCAGGGACGGGGATGCCGG + Intronic
1088912049 11:114199272-114199294 GGGCCCAGGGACGGGGATGCCGG + Intronic
1089003277 11:115069556-115069578 GGCCTCAGGGAACCGCGTGAGGG - Intergenic
1089466369 11:118689060-118689082 GAGCCCAGGGAGGCGGGGGAAGG + Intergenic
1090847871 11:130545978-130546000 GCCCCCAGGGATGGGGGTGAGGG + Intergenic
1091254704 11:134173260-134173282 GATCCCAGGGAGGCGGGGGATGG + Intronic
1091760620 12:3084947-3084969 GGCCCCAGGGAGGCGGGAGGAGG - Intronic
1092112194 12:5971567-5971589 GGCCCCCGGGACGGGGAGGAGGG - Intronic
1092161557 12:6318031-6318053 GGTCCCAGGGATACTGGTGAAGG + Intronic
1092249493 12:6884762-6884784 CACCACAGGGACGCGGGGGAGGG - Intronic
1092263309 12:6963589-6963611 GTCCCCAGGGACTCGGGTGGTGG + Intergenic
1092881130 12:12888612-12888634 GCCCCCAGGGACACAGGTGCAGG + Intergenic
1093153152 12:15647900-15647922 GACCCCAGGGCCGGGGATGATGG + Intronic
1095638372 12:44457645-44457667 GGCCCCAGGGGTGGGGGTGGTGG + Intergenic
1095960121 12:47829069-47829091 GGCCCCAGGCAAGTGGGGGAAGG - Intronic
1102201573 12:111061052-111061074 AGCCCCAAGGAAGCGGGGGAGGG - Intronic
1102516087 12:113447825-113447847 GGCTGCAGGGAAGAGGGTGAGGG + Intergenic
1104962420 12:132494518-132494540 GGCCCCAGTGACGCTGGCCATGG + Intronic
1105023030 12:132829569-132829591 GCCACCAGGGACGCAGATGAAGG - Intronic
1105067947 12:133216641-133216663 AGCCCCAGGGACAGGGGTGGAGG - Intergenic
1107555729 13:41515677-41515699 GGCCCCAGTGACGGGGTGGAGGG + Intergenic
1111122991 13:83879098-83879120 GGCCCCGGGGCCGAGGGCGAGGG + Exonic
1113592438 13:111510694-111510716 GACCCCAGGGACCCGTGGGAGGG + Intergenic
1113771694 13:112913715-112913737 TGCCCCAGGGATGCTGGGGAAGG + Intronic
1113808285 13:113122593-113122615 GTCACCAGGGCCGCGGGTGTGGG - Intergenic
1115754552 14:36518841-36518863 GGCGCCAGGGACTTGGGTGCGGG - Intronic
1118311428 14:64696395-64696417 GGCCACAGGGATGCAGGGGAGGG + Intergenic
1119406774 14:74403865-74403887 GGCCCCAGCCAGGCTGGTGATGG + Intergenic
1121013856 14:90536567-90536589 GACGCCAGGGATGAGGGTGAGGG - Exonic
1121174101 14:91877541-91877563 GGCCCCAGGGTAGCGGGTCGTGG + Exonic
1122226938 14:100285713-100285735 GGCCACAGGGACACGGGGCAGGG + Intergenic
1122264482 14:100540267-100540289 GGCCAAAGGGACTCTGGTGAGGG + Intronic
1122473656 14:101990399-101990421 GGCACCAGGGACCCAGGAGAAGG + Intronic
1122707213 14:103629003-103629025 GGTCACAGGGAGGAGGGTGACGG - Intronic
1126466426 15:48965064-48965086 GGACCCAGGGACCCAGGGGAAGG - Intergenic
1126666006 15:51077123-51077145 GGCCCCAGGGAAACAGGGGAGGG - Intronic
1129109495 15:73329323-73329345 GGCCCCAGTGACACTGGAGACGG + Intronic
1129159650 15:73740243-73740265 GACCCCAGGGACACGGGAGAGGG - Exonic
1130044377 15:80432199-80432221 TGCCCCAGAGACGCAGGTGAAGG - Intronic
1130348044 15:83067045-83067067 GGCCCCAGAGAGGACGGTGAGGG + Exonic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1132726856 16:1342658-1342680 CGCCCCAAGGACGGGGGTGGAGG - Intronic
1132747880 16:1444495-1444517 GTCCCCAGGGAGGCAGGTGTGGG + Intronic
1132752474 16:1465147-1465169 GGCCCCAGGGCCGGGGTTCAGGG - Intronic
1133239451 16:4405607-4405629 GGCACCAGGGAAGTGGGTGGGGG + Intronic
1136505192 16:30698581-30698603 GGCCCCGGGGCCCCGGCTGAGGG - Intronic
1137382712 16:48013677-48013699 GGCCCCAGGGAGGTGGGGGGGGG + Intergenic
1137580612 16:49631513-49631535 GGCCCCAGGGAAGGGGCTTATGG - Intronic
1138310912 16:56023094-56023116 GGTACCAGGGACGCAGGTGATGG + Intergenic
1138520018 16:57565728-57565750 CGGCCCAGGGACTGGGGTGAAGG + Intronic
1139504527 16:67392381-67392403 AGCCCCAGGGCTGCGGGTGTGGG - Intronic
1139511355 16:67430284-67430306 GGCCAGAGGGACGTCGGTGAAGG - Intergenic
1140406011 16:74712075-74712097 GGCTTCAGGGACTCGAGTGATGG + Intergenic
1140478396 16:75250285-75250307 GGGCCCAGGTACGGGGGTGGCGG - Intronic
1141482033 16:84313164-84313186 GGCCCGAGGGAGGGGGCTGAGGG + Intronic
1142193059 16:88726676-88726698 GGCCCCAGGGCGGTGGGTGCGGG + Intronic
1203120206 16_KI270728v1_random:1529626-1529648 GGTCCCAGGGCCGGGGGTGGGGG + Intergenic
1142518527 17:489568-489590 GGCCCTGGGCACGCGGGTGGAGG + Intergenic
1142590260 17:1001730-1001752 GCTCCCAGGGAAGCGGGGGATGG + Exonic
1143830291 17:9645642-9645664 GGCCCCGGGGACGCGGCAGGAGG + Exonic
1144945889 17:18969284-18969306 GGCCCCAGGGAGGAGGGACACGG - Exonic
1146018013 17:29249177-29249199 GGCCCCAGGGACCCCGGCGTAGG - Exonic
1148641555 17:49192077-49192099 CGCCCCAGGGACGCGCGTAACGG - Intergenic
1150315534 17:64165760-64165782 GGCACCAGGCACGTGGGTTAAGG + Intronic
1151598156 17:75090396-75090418 GGTCCCAGAGAGGCGGGGGAAGG + Intronic
1152109087 17:78347498-78347520 GGCCCCAGGGCCCCAGGTGAAGG + Intergenic
1152626539 17:81390306-81390328 GGCGCTGGGGACGAGGGTGAGGG + Intergenic
1152641792 17:81452371-81452393 GGCCGCAGGGTGGCGGGTGAGGG + Intronic
1152696914 17:81802263-81802285 GGCTGCAGGGACTGGGGTGAGGG - Intergenic
1153307819 18:3648881-3648903 TGCCCCAGGGAGGAGGGTGAAGG + Intronic
1154255516 18:12777852-12777874 GGGCCCAGGCACGCTGGTGCTGG + Intergenic
1158618890 18:59013140-59013162 AACCCCAGGGAGGCGGGAGAAGG - Intergenic
1160145632 18:76361842-76361864 GGCCCCAGGGAGGAGTGCGATGG + Exonic
1160861310 19:1238173-1238195 GGTCCCAGGGACGCAGCTGGGGG + Intergenic
1160930442 19:1567583-1567605 GGCCCCAGGGCCGCGGGGTGGGG + Exonic
1161034439 19:2076658-2076680 GGCCCCGGGGACCCTGCTGATGG - Intronic
1161565172 19:4997847-4997869 GGCCCCAGGGCCAGGAGTGAGGG + Intronic
1162127365 19:8506677-8506699 GGCCCCCGGGACCCTGGAGAGGG + Intergenic
1162150284 19:8640151-8640173 GGCCCCAGGAAGGTGGGTGAGGG - Intergenic
1162520520 19:11176726-11176748 GGCCCCAGAGCCGAGGGAGAGGG - Exonic
1162796141 19:13088613-13088635 GGGCCCAGGGATGGAGGTGAGGG - Intronic
1162799530 19:13103050-13103072 GGCCCCAGGGCAGCCGGGGAGGG + Intronic
1163475405 19:17523207-17523229 GGCCCCAGGGACGACAGTGTGGG + Intergenic
1163612262 19:18307773-18307795 GCCCCCAGGGATGCGGGGGGGGG + Intronic
1163696857 19:18768590-18768612 GGCTGCTGGGACGCGGGTGGAGG - Exonic
1164399911 19:27895341-27895363 GGCCCTAGGGAGGAGGCTGAAGG - Intergenic
1165144484 19:33722612-33722634 AGCCCCAGGGAAGAGGGGGAAGG - Intronic
1166316991 19:41994621-41994643 GGCACCAGGGACCCTGGAGACGG + Intronic
1166471783 19:43084304-43084326 GGCCCAAGTGACCCTGGTGAGGG + Intronic
1166539535 19:43596048-43596070 GGCCCCTGGGCCGCGGCGGACGG + Exonic
1166782757 19:45351002-45351024 GGCTCCTGGGACTCAGGTGAGGG + Exonic
1166792180 19:45404935-45404957 CCTCCCAGGGACGCGGGTGTTGG + Intronic
1167445200 19:49533569-49533591 GCCCCCGGGGTTGCGGGTGATGG + Intronic
1167610681 19:50506498-50506520 AGCCCCAGCGACACGGGCGAGGG + Exonic
1167710606 19:51108219-51108241 GGCCTCAGGGACACGGGCGCTGG + Intronic
1168008635 19:53512204-53512226 GGCCCCAGGGACGCGCCAGTGGG + Intergenic
1168315710 19:55483906-55483928 GGCCCCGGGGAGGCGGGGGATGG + Exonic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
1168494483 19:56838289-56838311 GGCCCCAGGGGCGGGCATGAGGG - Intronic
925848081 2:8051863-8051885 GGGCTCAGGGATGCGGGTGGCGG + Intergenic
926786222 2:16521079-16521101 GGCCACAGGGAATGGGGTGATGG + Intergenic
927256237 2:21043439-21043461 GCCCTCAGGGACCCGGGTGTAGG + Intronic
927772719 2:25878062-25878084 TGGCCCAGGGACCCGGCTGAAGG - Intronic
927852133 2:26506088-26506110 GGCCCCAAGGACAGGGGTGCTGG + Intronic
932767769 2:74482160-74482182 GGCCCCTGGGACGTGGCTCAAGG + Exonic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
935982534 2:108641458-108641480 GGCCCCTGGGATGGGGTTGATGG + Intronic
937270034 2:120643800-120643822 GACCCCAGGGATAAGGGTGAAGG - Intergenic
937637415 2:124171512-124171534 GACCCCAAGGACTCTGGTGATGG - Intronic
937882829 2:126881347-126881369 GGCCCCAGGGACTGGAGGGAGGG + Intergenic
938319796 2:130355530-130355552 GGCCCAAGGGAGGCCGGGGAGGG - Intergenic
942426206 2:175863404-175863426 GGCCCCTGGGATGAGGGAGAGGG - Intergenic
942451082 2:176108165-176108187 GGCCCGGGGGCCGCGGGGGAGGG + Intronic
946692326 2:222319206-222319228 GGCCCCACGGGCGAGGGCGAGGG + Intergenic
946763473 2:223018826-223018848 GGCTCCAGAGAAGAGGGTGAAGG - Intergenic
947670065 2:231930173-231930195 GGCCCCAGGGCTGCAGGGGAGGG + Intergenic
948458929 2:238119876-238119898 GGCCCCAGGGGCTGGGGTGGGGG - Intronic
948608676 2:239153012-239153034 GGTCCCAAGGTGGCGGGTGAAGG + Intronic
948942240 2:241202368-241202390 GCCCCCAGGGAGGCGGGTGTGGG + Intronic
1169208152 20:3751478-3751500 GGACGGGGGGACGCGGGTGAAGG - Intronic
1169496770 20:6123035-6123057 GGCCCCAGCGGCCCGGCTGAGGG + Exonic
1170562634 20:17570174-17570196 GGTCGCAGGGACGCGGGGGAGGG - Exonic
1170712973 20:18808658-18808680 GGGGCCAGGGAAGTGGGTGATGG + Intergenic
1170882082 20:20305578-20305600 GGCCGCAGGGAAGCGTGTGAGGG - Intronic
1171223517 20:23421477-23421499 GGCCGCAGGGACGCAGGCGCAGG + Exonic
1172619617 20:36310351-36310373 GGCCACAGGGAGGCTGGTGGTGG + Intronic
1175267313 20:57710328-57710350 GACCCCAGGGACGGGGGCGAGGG - Intronic
1175322302 20:58097645-58097667 GGCACCAGGGGAGGGGGTGATGG + Intergenic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1175653977 20:60752911-60752933 GGGTCCAGGGACACGGGTGTGGG - Intergenic
1176407858 21:6431223-6431245 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1179683349 21:43039554-43039576 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1179989497 21:44939900-44939922 GGGCGCAGGGTCGCGGGTGTAGG - Intronic
1180092405 21:45539831-45539853 GGCCGCAGGGAAGAGGGGGAAGG + Intronic
1180131004 21:45827095-45827117 GTCCCCAGGGACGCGGGAGTGGG - Intronic
1180354087 22:11824586-11824608 GGGCCCAGGGAAGGGGCTGATGG + Intergenic
1180384158 22:12167739-12167761 GGGCCCAGGGAAGGGGCTGATGG - Intergenic
1180869744 22:19139411-19139433 GGCCCCAGTGCCGCTGGAGAGGG + Intronic
1181032444 22:20155021-20155043 GTGCCCAGGGGCGAGGGTGACGG - Intergenic
1182551108 22:31101113-31101135 GGGTCCAGGGAGGCGGGTGGGGG + Intronic
1183248835 22:36713905-36713927 GGACCCAGGGAAGAGGGTGCAGG - Intergenic
1184332025 22:43833391-43833413 GGACCCAGGAAGGCGGGTGTGGG - Intronic
1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG + Intronic
1184548839 22:45192945-45192967 GACCCCTGGGAGCCGGGTGATGG - Intronic
1184757610 22:46525852-46525874 GGCCCCAGTGTCGCTGCTGAAGG - Intronic
1184765171 22:46568483-46568505 GGCCCCAGGGAAGTGGCAGAGGG - Intergenic
1185006192 22:48278264-48278286 GGCCCCGAGGAGGCGGGAGATGG - Intergenic
1185237900 22:49725311-49725333 GGGCCCAGGGAGGAGGGAGAGGG - Intergenic
1185366302 22:50438509-50438531 GGCCCCAGGCTCGGGGCTGAGGG - Intronic
953901386 3:46845971-46845993 GGGCACAGGGGCGCGGGTGGCGG - Intergenic
961566753 3:127769547-127769569 AGGCCCAGGGAGGCTGGTGAGGG + Intronic
961817969 3:129561114-129561136 GGCCCCAGGCAGGCGGGGGTGGG + Intronic
966852080 3:184170615-184170637 GGCCCCATGGCCGCGGGCGGCGG - Exonic
966913424 3:184571673-184571695 GGACCCAGGGAGGAGGGAGATGG - Intronic
967087297 3:186107666-186107688 GGCGCCCGGGGCGCGGGTGGTGG - Intronic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
969344458 4:6562572-6562594 GGGCCCAGTGAGGTGGGTGATGG - Intronic
969674857 4:8608836-8608858 AGCCCCAGGGAGCCGGGTGCAGG + Intronic
969680408 4:8640106-8640128 GGCCCCAGGGACTCCGGAGAGGG - Intergenic
971351811 4:25862612-25862634 GGCCCCGGGGACGCGGGTGGGGG - Intronic
973230981 4:47838135-47838157 GGACCCAGAGACGGGAGTGAAGG - Intergenic
975529512 4:75386071-75386093 GGCCCCAGGGAGGCTGGAGAGGG - Intergenic
984143430 4:176032097-176032119 GGCCCCAGGCACGAGGGAGGAGG - Intergenic
984811159 4:183797546-183797568 GGCTGCAGGGACGCGGGCGCGGG + Intergenic
985508770 5:299998-300020 GGGCCCAGGGATGTGGGTGATGG + Intronic
985616290 5:923638-923660 GGGCCCAGGGCCGCTGGTGCTGG - Intergenic
985714007 5:1445722-1445744 GCCCCCAGGGGTGCGGGCGAGGG - Intergenic
985739354 5:1605918-1605940 GGGCCCAGGGATGTGGGTGATGG - Intergenic
986270620 5:6227709-6227731 GGCCCTAGGGAGGCACGTGAGGG - Intergenic
988086952 5:26485364-26485386 GAACCCAGGGAGGCGGGGGAAGG + Intergenic
991391045 5:66144129-66144151 AGCCCCAGGGACCCGGGAGCTGG + Intronic
992487477 5:77210528-77210550 TGGCCCAGGGCCGCGGGTGCGGG + Intronic
995402399 5:111757627-111757649 GGCGCCCGGGGCGCGGGTGCGGG - Intronic
995478892 5:112575891-112575913 GGCTCCAGGGTAGTGGGTGAGGG - Intergenic
997304569 5:132828164-132828186 GGCCTCAGGGACGTGGGTGGAGG - Intronic
997816936 5:137028175-137028197 TTCCCCAGGGACACAGGTGAAGG + Intronic
998139722 5:139693050-139693072 GGCCGCAGGGTCAGGGGTGAGGG - Intergenic
999239274 5:150118199-150118221 GGTCCCAGGGACCTGGGAGATGG - Intronic
999257410 5:150217230-150217252 TGCCCCAGGGAAGCAGGTGTGGG + Intronic
1000463276 5:161547693-161547715 GGCGTGAGGGATGCGGGTGACGG + Intronic
1002199769 5:177521161-177521183 GACCCCAGGGACACAGCTGAGGG + Intronic
1003158794 6:3618258-3618280 GGCCCCAGTGCCGGGGGTGGGGG + Intergenic
1006136133 6:31897376-31897398 GGCCCCAGGAGCACGCGTGAGGG - Intronic
1006645345 6:35511616-35511638 GGCCCCAGGGACGCGGGTGAGGG - Intronic
1006847362 6:37071878-37071900 GGCCCCAGGGCTTTGGGTGAGGG - Intergenic
1007390367 6:41546882-41546904 GGGCCCAGGGACGTGGGTGGGGG + Intronic
1015440412 6:133241203-133241225 GCCGCCAGGGACGCGGGGGGCGG - Intronic
1016314500 6:142771318-142771340 GGACCCAGGGAAGCAGGTGGCGG - Exonic
1016429097 6:143964244-143964266 TGCCCCAGGGCCGCCAGTGAGGG - Intronic
1016937321 6:149456911-149456933 GGCGACGGAGACGCGGGTGAGGG + Intronic
1018802775 6:167236373-167236395 GCCCCCAGGGCAGCGGGTGGAGG + Intergenic
1019191956 6:170256685-170256707 AGCCCCTGGGACCCGGGGGATGG + Intergenic
1019282079 7:205675-205697 GGCCCCAGGCAGGAGGGAGATGG - Intronic
1019415639 7:925484-925506 GGCCCCTGGAAGGCGGGTGGGGG - Intronic
1024085517 7:45888939-45888961 GGCGCCTTGGCCGCGGGTGAGGG - Exonic
1025784699 7:64633779-64633801 GGCCCCAGTGACCCGTGTGTTGG - Intergenic
1028184926 7:87771669-87771691 GGCCCCAGGGATGGGGGTGAAGG + Intronic
1029506431 7:100966300-100966322 GGCCCCGCGGGGGCGGGTGAGGG - Intronic
1034154186 7:148941080-148941102 AGCCACAGGCACGCGAGTGACGG + Intergenic
1034318841 7:150160755-150160777 GGCACCAGGAACACAGGTGAAGG - Intergenic
1034773916 7:153806450-153806472 GGCACCAGGAACACAGGTGAAGG + Intergenic
1035822770 8:2612242-2612264 GGCCACAGGGACACAGATGAGGG - Intergenic
1037768942 8:21787944-21787966 GGCGGCAGGGACGCGGACGAGGG - Intronic
1037834212 8:22206833-22206855 GGCTGCAGGGAAGCGAGTGACGG - Exonic
1040065447 8:43140808-43140830 GGCCCCGCGGAGGCGGGGGAGGG + Intronic
1040285654 8:46099203-46099225 GGCCACAGGCAGGCTGGTGAGGG + Intergenic
1040289775 8:46118325-46118347 GGCCCCAGGGACTCAGGAGGAGG - Intergenic
1040471423 8:47738241-47738263 CGCCCCGGGGCCGCGGGGGAAGG + Exonic
1042065039 8:64865174-64865196 AGACCCAGGCACGAGGGTGAGGG - Intergenic
1042695141 8:71547593-71547615 GGCGCCCGGGAAGCGGCTGAGGG - Exonic
1043557862 8:81454398-81454420 GGCCCCAGGGAGACAGGGGAGGG + Intergenic
1045035969 8:98176681-98176703 GGCCCCAGGGACACCGGGCACGG + Intergenic
1048013386 8:130476635-130476657 GGCCCCAGGGACTGTGCTGAGGG - Intergenic
1048993319 8:139774096-139774118 GGCCACATGGACGCGGGCGAAGG + Intronic
1049541712 8:143211728-143211750 GGGCGCAGGGAGGCGGGTGGGGG + Intergenic
1049542189 8:143213692-143213714 GGCCCCAGGGTGGCTGGGGAGGG - Intergenic
1049644245 8:143728928-143728950 GGCCCCAGAGAAGGGGGTGAGGG + Intronic
1049989228 9:976566-976588 GACCCCAGGGGCGGGGGTGGCGG + Intergenic
1053123014 9:35560309-35560331 AGCCCAAGGGGAGCGGGTGAAGG + Exonic
1053280317 9:36816328-36816350 GGCCCCAGTGTTGGGGGTGAAGG + Intergenic
1057218649 9:93243781-93243803 GACCCCAGGGAGGCCAGTGACGG - Intronic
1059426715 9:114225800-114225822 GGCTGCAGGGACCCGGGGGACGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060479146 9:124007893-124007915 GGCCCCAGGCAGGCGGGTCTGGG + Intronic
1060733056 9:126050011-126050033 GTCCCCTGGGACGGGGGTGGGGG + Intergenic
1061053471 9:128209366-128209388 GGACCCAGGGAAGGGGGTGCAGG + Intronic
1061884386 9:133584238-133584260 GTCCCCAGGGAGGAGGCTGAAGG - Intronic
1062318506 9:135979425-135979447 GCCCCCGGGGACGCGGCTGCAGG + Intergenic
1062469201 9:136694945-136694967 GGCGCCGGGGATGCGGATGAAGG - Intergenic
1062634908 9:137485701-137485723 GACCCCGGAGACGCGAGTGAGGG + Intronic
1185877436 X:3712697-3712719 GGCCCCAGGGACACTGGCGCGGG - Intronic
1185893992 X:3842944-3842966 GGCCCCAGGGACACGGGCGCGGG - Intronic
1185899109 X:3881368-3881390 GGCCCCAGGGACACGGGCGCGGG - Intergenic
1185904226 X:3919797-3919819 GGCCCCAGGGACACGGGCGCGGG - Intergenic
1186425817 X:9464336-9464358 GGCGCCAGGAACTCGGGTGTGGG - Intronic
1188451185 X:30309258-30309280 GGCTCCAGAGACGCGGCTGGTGG - Exonic
1190057572 X:47190742-47190764 GGCACCAGCGACGCGGGAGCAGG + Intergenic
1191740522 X:64432509-64432531 GGCCCCAGGGATGAGGCTGATGG - Intergenic
1192079300 X:68032212-68032234 TGCCCCAGGCACAAGGGTGAGGG + Intergenic
1200151457 X:153953411-153953433 CGCCCCAGAGATGCGGGGGACGG + Intronic
1200787863 Y:7274841-7274863 GGCCCCAGGGACACGGGCGCGGG + Intergenic