ID: 1006646968

View in Genome Browser
Species Human (GRCh38)
Location 6:35521528-35521550
Sequence CTGTTAACACAGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006646968_1006646978 27 Left 1006646968 6:35521528-35521550 CCTACTTCCCTCTGTGTTAACAG No data
Right 1006646978 6:35521578-35521600 TCCATGCCAGTCCCCCCAAGAGG No data
1006646968_1006646980 28 Left 1006646968 6:35521528-35521550 CCTACTTCCCTCTGTGTTAACAG No data
Right 1006646980 6:35521579-35521601 CCATGCCAGTCCCCCCAAGAGGG No data
1006646968_1006646981 29 Left 1006646968 6:35521528-35521550 CCTACTTCCCTCTGTGTTAACAG No data
Right 1006646981 6:35521580-35521602 CATGCCAGTCCCCCCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006646968 Original CRISPR CTGTTAACACAGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr