ID: 1006647887

View in Genome Browser
Species Human (GRCh38)
Location 6:35527639-35527661
Sequence TTCAAGATATACAACTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006647887_1006647889 9 Left 1006647887 6:35527639-35527661 CCAGTCAAGTTGTATATCTTGAA No data
Right 1006647889 6:35527671-35527693 ATTCTGAGACTGAAGCGTGTGGG No data
1006647887_1006647890 25 Left 1006647887 6:35527639-35527661 CCAGTCAAGTTGTATATCTTGAA No data
Right 1006647890 6:35527687-35527709 GTGTGGGACTGAGCTTTATTAGG No data
1006647887_1006647891 26 Left 1006647887 6:35527639-35527661 CCAGTCAAGTTGTATATCTTGAA No data
Right 1006647891 6:35527688-35527710 TGTGGGACTGAGCTTTATTAGGG No data
1006647887_1006647888 8 Left 1006647887 6:35527639-35527661 CCAGTCAAGTTGTATATCTTGAA No data
Right 1006647888 6:35527670-35527692 TATTCTGAGACTGAAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006647887 Original CRISPR TTCAAGATATACAACTTGAC TGG (reversed) Intergenic
No off target data available for this crispr