ID: 1006650822

View in Genome Browser
Species Human (GRCh38)
Location 6:35549879-35549901
Sequence ACTGCCAGGCTGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006650815_1006650822 18 Left 1006650815 6:35549838-35549860 CCTTTTCCAAGGAGTAGGTCAAT No data
Right 1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG No data
1006650813_1006650822 24 Left 1006650813 6:35549832-35549854 CCAGGGCCTTTTCCAAGGAGTAG No data
Right 1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG No data
1006650817_1006650822 12 Left 1006650817 6:35549844-35549866 CCAAGGAGTAGGTCAATGCTGGG No data
Right 1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006650822 Original CRISPR ACTGCCAGGCTGACTGTGGA AGG Intergenic
No off target data available for this crispr