ID: 1006658377

View in Genome Browser
Species Human (GRCh38)
Location 6:35617078-35617100
Sequence CTATCTCCCAACTCCTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006658370_1006658377 8 Left 1006658370 6:35617047-35617069 CCAGCCTGAGGCCAGGGCTGAGG 0: 1
1: 0
2: 4
3: 71
4: 569
Right 1006658377 6:35617078-35617100 CTATCTCCCAACTCCTAGTCTGG No data
1006658372_1006658377 4 Left 1006658372 6:35617051-35617073 CCTGAGGCCAGGGCTGAGGCTGG 0: 1
1: 2
2: 10
3: 145
4: 872
Right 1006658377 6:35617078-35617100 CTATCTCCCAACTCCTAGTCTGG No data
1006658374_1006658377 -3 Left 1006658374 6:35617058-35617080 CCAGGGCTGAGGCTGGAACCCTA 0: 1
1: 1
2: 1
3: 26
4: 264
Right 1006658377 6:35617078-35617100 CTATCTCCCAACTCCTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006658377 Original CRISPR CTATCTCCCAACTCCTAGTC TGG Intronic
No off target data available for this crispr