ID: 1006665413

View in Genome Browser
Species Human (GRCh38)
Location 6:35689390-35689412
Sequence TAAGATGCCCAGTCGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006665404_1006665413 11 Left 1006665404 6:35689356-35689378 CCAGGTTAGCCCTAGGAAGCAAC 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG 0: 1
1: 0
2: 0
3: 2
4: 86
1006665406_1006665413 1 Left 1006665406 6:35689366-35689388 CCTAGGAAGCAACCCCATTAAGT 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG 0: 1
1: 0
2: 0
3: 2
4: 86
1006665405_1006665413 2 Left 1006665405 6:35689365-35689387 CCCTAGGAAGCAACCCCATTAAG 0: 1
1: 0
2: 3
3: 7
4: 89
Right 1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006665413 Original CRISPR TAAGATGCCCAGTCGGGACT GGG Intronic
902465681 1:16616730-16616752 TATGCTGCCCAGGCTGGACTTGG + Intergenic
903678462 1:25081586-25081608 TCAGATGGCCACTCTGGACTGGG + Intergenic
909939975 1:81600170-81600192 TAAGATGTCCAGCCTGGAATAGG + Intronic
916238407 1:162613791-162613813 AAACATGCCCAGCCGGGACAAGG - Intergenic
916672291 1:167033301-167033323 TATGTTGCCCAGACTGGACTCGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1063033684 10:2262906-2262928 TAAGATGGCCAGAGGGGGCTGGG + Intergenic
1063777804 10:9283911-9283933 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1088409963 11:109523227-109523249 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1089169976 11:116505067-116505089 TCAGCTGCCCAGCCAGGACTGGG + Intergenic
1093875214 12:24341845-24341867 AAAGCTGCCCAGTGGGCACTGGG - Intergenic
1095713438 12:45315380-45315402 TAATAGTCCCAGTGGGGACTGGG + Intronic
1099320777 12:81145778-81145800 GAAGATGCCCAGTCAAGAGTTGG + Intronic
1099494302 12:83326880-83326902 TCAGATGCCTAGATGGGACTTGG - Intergenic
1102832966 12:116024165-116024187 TCTGATGCACAGTTGGGACTCGG - Intronic
1103691936 12:122782131-122782153 TATGTTGCCCAGGCTGGACTTGG - Intronic
1112895502 13:104294764-104294786 TTAGATGCACATTCTGGACTGGG + Intergenic
1115512097 14:34147578-34147600 TAGGATGCCCAGTCTGGTGTGGG + Intronic
1118223692 14:63879005-63879027 TATGTTGCCCAGTCTGGTCTTGG - Intronic
1121355613 14:93211649-93211671 TATGATGCCCAGGCTGGTCTGGG - Intronic
1122491422 14:102118440-102118462 TATGTTGCCCAGTCTGGTCTTGG + Intronic
1126120057 15:45243358-45243380 TATGTTGCCCAGGCTGGACTCGG - Intergenic
1127394583 15:58534214-58534236 AAAGATGCCCAGTCGAGAGCTGG + Intronic
1131275932 15:90980860-90980882 TAAGAAACCCAGTGGGTACTGGG - Intronic
1134142584 16:11734268-11734290 TATGATGTCCAGGCAGGACTTGG + Intronic
1140377725 16:74458392-74458414 TAAAATTCTCAATCGGGACTGGG + Intronic
1143239930 17:5435283-5435305 TGAGATGCCCAGTCAGCACATGG - Intronic
1143516200 17:7420403-7420425 TACGAGGCCCACTCGGGCCTCGG - Exonic
1150469214 17:65422124-65422146 TAAGTTACCCAGTCTGGGCTGGG + Intergenic
1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG + Intronic
1150814299 17:68380468-68380490 TATGTTGCCCAGTCTGGTCTCGG + Intronic
1153073403 18:1132790-1132812 GAAGATGCCCAGTGAAGACTGGG + Intergenic
1158956508 18:62545182-62545204 TAAGTTGCCCAGTCTGGTCTTGG - Intronic
1165068984 19:33244628-33244650 TATGTTGCCCAGGCTGGACTCGG + Intergenic
1168699029 19:58424763-58424785 TATGTTGCCCAGGCTGGACTTGG - Intergenic
925526866 2:4813051-4813073 TAAATTGCCCAGTCTGGAGTAGG - Intergenic
930742679 2:54847942-54847964 TAACATCCCCAGTGGGGGCTGGG - Intronic
931512454 2:63015546-63015568 TATGTTGCCCAGGCTGGACTGGG + Intronic
932219531 2:69989284-69989306 TAAAAGGCCCAGCCAGGACTTGG - Intergenic
934712552 2:96525528-96525550 TAAGATGCTGAGTGGGCACTTGG - Intergenic
939610868 2:144308713-144308735 TCTGTTGCCCAGTCAGGACTGGG - Intronic
948352672 2:237353792-237353814 AATGGTGCCCAGTGGGGACTTGG - Intronic
1171103251 20:22406505-22406527 TAAAATACCCAGTGGGGTCTAGG - Intergenic
1172928473 20:38563112-38563134 TAAGTTACCCTGTCAGGACTGGG - Intronic
1173263688 20:41459262-41459284 TAAGAAGCCCAGTAAGTACTGGG + Intronic
1173983675 20:47244495-47244517 TAACATGCCCAGGCTGCACTAGG + Intronic
1174714381 20:52741768-52741790 TAAGCTTCCCAGTCAAGACTGGG + Intergenic
1178029839 21:28511776-28511798 GAAGCTGCCCAGTCAGTACTTGG - Intergenic
1178191786 21:30290982-30291004 TAAGATGCCAAGTGGCTACTTGG - Intergenic
1182350124 22:29694768-29694790 AAAGAAGGCCACTCGGGACTTGG - Exonic
1182582159 22:31320690-31320712 TATGTTGCCCAGGCTGGACTGGG + Intergenic
950724830 3:14910446-14910468 TAAGTTGCCCAGGCTGGTCTTGG + Intronic
950904826 3:16528651-16528673 TAAGTGGCCCACTGGGGACTGGG - Intergenic
956628425 3:71290067-71290089 TAAGATGCCAAGTGGGCATTTGG - Intronic
959533341 3:107458351-107458373 TAAGTTCCCCAGTAGGTACTTGG - Intergenic
961066136 3:123878979-123879001 TAAGATGCCAAGTGGTGGCTGGG - Intronic
974054311 4:56970268-56970290 TATGTTGCCCAGTCTGGTCTAGG - Intronic
975122833 4:70747811-70747833 TATGTTGCCCAGGCTGGACTTGG - Intronic
979419408 4:120485684-120485706 TTAGATGCCCAGTTGGAAGTTGG + Intergenic
980022755 4:127729457-127729479 TATGTTGCCCAGGCTGGACTTGG + Intergenic
981171125 4:141624470-141624492 TAAGTTGCTGAGTTGGGACTTGG - Intergenic
981364445 4:143885741-143885763 TAACATGCTCAGATGGGACTTGG - Intronic
981374940 4:144004025-144004047 TAACATGCCCAGATGGGACTTGG - Intronic
981385561 4:144126213-144126235 TAACATGCTCAGATGGGACTTGG - Intronic
985097856 4:186430585-186430607 TTAGAGGCCCAGTCGGGATCAGG + Intronic
991284342 5:64954483-64954505 TATGTTGCCCAGCCTGGACTCGG + Intronic
995215831 5:109593207-109593229 AAAGATGGCCAGTTGGGAATAGG - Intergenic
997593568 5:135091315-135091337 GAAGATGCCAAGTGGGGAATGGG + Intronic
1004600875 6:17148823-17148845 TAAGATGCACATTCCAGACTAGG + Intergenic
1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG + Intronic
1007603364 6:43097754-43097776 TAAGATTTCCAGTGGGCACTGGG - Intronic
1011027202 6:82882055-82882077 TAAGATGAACAGTAGGGAATCGG - Intergenic
1015606213 6:134956938-134956960 TAAAATCCCCAGTCAGGGCTGGG + Intergenic
1016964979 6:149710431-149710453 CAATAGGCCCAGTCAGGACTTGG - Intronic
1017933988 6:158988189-158988211 TGAGATGACCAGGAGGGACTGGG - Intronic
1020698912 7:11452614-11452636 TAAGATCCCCAGTTGGGATCTGG + Intronic
1020967371 7:14888387-14888409 TAAGATGCCCAGTAAGGAAGAGG - Intronic
1023522268 7:41060436-41060458 CAGGCTGCCCAGTCGGGGCTTGG - Intergenic
1034189973 7:149206554-149206576 TGAGATGGACAGTGGGGACTGGG + Intronic
1034430359 7:151038225-151038247 TAAGAAGCCCAGTGGCGGCTGGG + Intronic
1044563979 8:93643400-93643422 TATGTTGCCCAGTCTGGTCTCGG + Intergenic
1047970756 8:130082401-130082423 TAAGTTGCCCAGGCTGGTCTTGG + Intronic
1055769394 9:79701215-79701237 TAAGCTGCACAGTGGGCACTGGG - Intronic
1061428481 9:130516167-130516189 TATGTTGCCCAGTCTGGTCTTGG - Intergenic
1187714048 X:22084194-22084216 TATGCTGCCCAGGCTGGACTTGG + Intronic
1190099415 X:47509680-47509702 TATGTTGCCCAGGCTGGACTGGG + Intergenic
1190235995 X:48616272-48616294 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1192415427 X:70975548-70975570 TATGTTGCCCAGGCTGGACTAGG + Intergenic
1194765972 X:97845594-97845616 GAAGAGGCCAAGTCGGGAGTTGG - Intergenic