ID: 1006671479

View in Genome Browser
Species Human (GRCh38)
Location 6:35732083-35732105
Sequence GACCGGGGGAGGCCCGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006671463_1006671479 22 Left 1006671463 6:35732038-35732060 CCGGATGCGCGCGGGGGGAGGAG No data
Right 1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG No data
1006671459_1006671479 28 Left 1006671459 6:35732032-35732054 CCGTCGCCGGATGCGCGCGGGGG No data
Right 1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG No data
1006671470_1006671479 -6 Left 1006671470 6:35732066-35732088 CCGGGGAGGGAGAGCAAGACCGG No data
Right 1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG No data
1006671457_1006671479 29 Left 1006671457 6:35732031-35732053 CCCGTCGCCGGATGCGCGCGGGG No data
Right 1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006671479 Original CRISPR GACCGGGGGAGGCCCGGGAC GGG Intergenic
No off target data available for this crispr