ID: 1006671501

View in Genome Browser
Species Human (GRCh38)
Location 6:35732143-35732165
Sequence GAGGGGGCCAGCGCCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006671501_1006671510 8 Left 1006671501 6:35732143-35732165 CCTCTGGGGGCGCTGGCCCCCTC No data
Right 1006671510 6:35732174-35732196 GCGCCTTAGGCTGAGCTACCCGG No data
1006671501_1006671512 11 Left 1006671501 6:35732143-35732165 CCTCTGGGGGCGCTGGCCCCCTC No data
Right 1006671512 6:35732177-35732199 CCTTAGGCTGAGCTACCCGGAGG No data
1006671501_1006671513 18 Left 1006671501 6:35732143-35732165 CCTCTGGGGGCGCTGGCCCCCTC No data
Right 1006671513 6:35732184-35732206 CTGAGCTACCCGGAGGCCCCAGG No data
1006671501_1006671514 24 Left 1006671501 6:35732143-35732165 CCTCTGGGGGCGCTGGCCCCCTC No data
Right 1006671514 6:35732190-35732212 TACCCGGAGGCCCCAGGATCTGG No data
1006671501_1006671505 -5 Left 1006671501 6:35732143-35732165 CCTCTGGGGGCGCTGGCCCCCTC No data
Right 1006671505 6:35732161-35732183 CCCTCTGCTCCCCGCGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006671501 Original CRISPR GAGGGGGCCAGCGCCCCCAG AGG (reversed) Intergenic
No off target data available for this crispr