ID: 1006671600

View in Genome Browser
Species Human (GRCh38)
Location 6:35732713-35732735
Sequence CAACTACCTGTGGAATCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006671600_1006671605 3 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671605 6:35732739-35732761 GGTTCTTAGGAACACAGTTTAGG No data
1006671600_1006671607 5 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671607 6:35732741-35732763 TTCTTAGGAACACAGTTTAGGGG No data
1006671600_1006671606 4 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671606 6:35732740-35732762 GTTCTTAGGAACACAGTTTAGGG No data
1006671600_1006671604 -10 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671604 6:35732726-35732748 CAGGTAGTTGGATGGTTCTTAGG No data
1006671600_1006671608 18 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671608 6:35732754-35732776 AGTTTAGGGGAATGTGTTGCAGG No data
1006671600_1006671609 19 Left 1006671600 6:35732713-35732735 CCTTAGGATTCCACAGGTAGTTG No data
Right 1006671609 6:35732755-35732777 GTTTAGGGGAATGTGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006671600 Original CRISPR CAACTACCTGTGGAATCCTA AGG (reversed) Intergenic
No off target data available for this crispr