ID: 1006672378

View in Genome Browser
Species Human (GRCh38)
Location 6:35737394-35737416
Sequence CAGGGTGGGCTTGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672378_1006672390 19 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1006672378_1006672392 26 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672378_1006672383 -6 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1006672378_1006672389 18 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672378 Original CRISPR CAGGGTGGGCTTGAGGAAGA TGG (reversed) Intronic