ID: 1006672378

View in Genome Browser
Species Human (GRCh38)
Location 6:35737394-35737416
Sequence CAGGGTGGGCTTGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672378_1006672389 18 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672378_1006672392 26 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672378_1006672390 19 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1006672378_1006672383 -6 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672378 Original CRISPR CAGGGTGGGCTTGAGGAAGA TGG (reversed) Intronic
900403605 1:2482945-2482967 CAGAGTGGGGTCGAGGAAGCAGG - Intronic
900457827 1:2785970-2785992 CAGGGTGGGCTGGAGGCAGGCGG + Exonic
900647222 1:3714440-3714462 CAGGGTGGGGGTGAGGATGGTGG + Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900854592 1:5170765-5170787 CAGGGTGAGATTTAGGAAGAGGG + Intergenic
901087449 1:6620066-6620088 CAGGGGGGGCTTGCTGAAGCTGG + Exonic
901689647 1:10964384-10964406 GAAGGTGGGCTTGTGGAAGAGGG + Intronic
901690133 1:10967432-10967454 CAGGGTGGGCTTCATGGAGAAGG - Intronic
901738115 1:11325160-11325182 CAGGGTGGGCGGGAGGCGGACGG - Intergenic
901771845 1:11534567-11534589 CTGGGTGGGCAGGAGGCAGAGGG + Intronic
901859465 1:12064677-12064699 CAGAGTGGGCTTTAGGCAGGAGG + Intronic
902377642 1:16037296-16037318 CAGGGAAGGCTTCTGGAAGAGGG + Intergenic
902396986 1:16137789-16137811 CAGGTGGGGCTTAAGGAGGACGG - Intronic
902738008 1:18413993-18414015 CAGGGGAGGTTTGAGGAAGGAGG + Intergenic
902755727 1:18548106-18548128 CAGGGTGGGCTGGAGAGAGGAGG - Intergenic
902979756 1:20114183-20114205 CAGGTTGCGCTTCAGGCAGAAGG + Exonic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903565380 1:24261417-24261439 CAGGGTGGGCTTTTGAGAGAAGG - Intergenic
904069730 1:27784900-27784922 TAGGGAGGGGTTGAGGAAGTGGG - Intronic
904271282 1:29351767-29351789 CAGGGAGGGCTTCACTAAGAAGG - Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905115044 1:35631417-35631439 GATGGTGGGCTTTAGGAACAGGG - Intronic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
905624609 1:39480033-39480055 GAGGGTGGGATTGGGGAAGAAGG - Intronic
905640128 1:39583491-39583513 CAGGGTTGGGAAGAGGAAGAAGG + Intergenic
905751247 1:40466411-40466433 CAGGATAGGCTTCAGTAAGAAGG - Intergenic
905892670 1:41527043-41527065 GAGGGTGTGTGTGAGGAAGAGGG - Intronic
905892682 1:41527115-41527137 GAGGGTGTGTGTGAGGAAGAGGG - Intronic
906159083 1:43634473-43634495 CAGGAAGGGCTCCAGGAAGAGGG - Intergenic
906197054 1:43936026-43936048 CCAGGTGGGCTTGGGGAGGAAGG - Intronic
906658668 1:47567082-47567104 TAGGCTGGGCCTGAGGAAGCTGG - Intergenic
908497854 1:64712984-64713006 CAGCGTGGGCTTCATGGAGAAGG + Intergenic
909857536 1:80557047-80557069 AAGGGAGGCATTGAGGAAGATGG - Intergenic
912178179 1:107186010-107186032 GAGGGTGGGCGTGAGGGCGAGGG - Intronic
912933470 1:113983573-113983595 CAGGGAGGGGTTGAGGGGGAAGG + Intergenic
914901420 1:151713223-151713245 CAGGGTGGGGGTGAGGAAGAAGG - Intronic
914941872 1:152030249-152030271 CAGGGCTTGATTGAGGAAGAAGG + Intergenic
915166991 1:153953462-153953484 CAGGGTGGGGGTGAGGGAGCAGG + Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916191163 1:162179725-162179747 CAGGGAGGGCTGGAGAGAGATGG + Intronic
917916007 1:179702784-179702806 GAGGTGGGGCTTGAGCAAGAGGG - Intergenic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
918246539 1:182665198-182665220 CAGAGCAGGGTTGAGGAAGAGGG - Intronic
918457003 1:184731587-184731609 GAGGGAGGGCATGAGGAGGAAGG - Intronic
918771190 1:188562527-188562549 CAGTGTGGGTGTGAGGAGGAGGG - Intergenic
919723874 1:200869623-200869645 AGGGGTGGGATGGAGGAAGAGGG + Intergenic
920183434 1:204146565-204146587 CAGGGTGGGCTGGAGCCAAAAGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
922252810 1:223864989-223865011 CAGGGTGGGGGTGAAGGAGAGGG - Intergenic
922445609 1:225694519-225694541 CAGGCCGGGGTTGAGGAAGCAGG + Intergenic
922594451 1:226803215-226803237 CACGGGGGTCTGGAGGAAGAAGG - Intergenic
922653986 1:227364896-227364918 CAAGGTGGGAGTGAAGAAGAGGG + Intergenic
923213057 1:231823486-231823508 CAAGGTGCTTTTGAGGAAGAAGG - Intronic
924362505 1:243255807-243255829 CAGGCTGGGCTGGAGGAAAAGGG + Intergenic
924370893 1:243348551-243348573 CAGGGCGGGATAGAGGAAGCTGG + Intronic
1063000928 10:1921713-1921735 CTGGGTGGGCATGAGAAAGAGGG + Intergenic
1063113092 10:3053536-3053558 AAGGGTGGGCTGGAGGGAAAAGG - Intergenic
1063113137 10:3053644-3053666 AAGGGTGGGCTGGAGGGAAAAGG - Intergenic
1063113174 10:3053734-3053756 AAGGGTGGGCTGGAGGGAAAAGG - Intergenic
1063113187 10:3053770-3053792 AAGGGTGGGCTGGAGGGAAAAGG - Intergenic
1063176236 10:3553111-3553133 CAGGGTGGGCCTGAGCAAAGAGG - Intergenic
1063463535 10:6229252-6229274 CAGGGTGGTCTTAAGGAACGTGG - Intronic
1063614643 10:7591315-7591337 CAGGGTGGGTTTAGGGAAGCTGG - Intronic
1063735152 10:8745054-8745076 GAGGGAGGGCCTAAGGAAGAAGG - Intergenic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1063898682 10:10709422-10709444 CAGGGTGGGCGTGGGGAGGAAGG - Intergenic
1064321405 10:14308808-14308830 CAGGTTGGGCTTGAAGAAACTGG + Intronic
1064923618 10:20545801-20545823 CAGGCTAGGCTTATGGAAGAAGG + Intergenic
1065532356 10:26685250-26685272 CTAAGTCGGCTTGAGGAAGACGG + Intergenic
1065664537 10:28043468-28043490 ATGGGTAGGTTTGAGGAAGAAGG - Intergenic
1066460457 10:35608273-35608295 GAGGGTGGGCGGGAGGAAGAGGG + Exonic
1066745911 10:38604199-38604221 CAGGGAGGGCTGGAGGGTGATGG - Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067083622 10:43227022-43227044 CAGGGAGGGCTTCATGAAGGAGG + Intronic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067735640 10:48848187-48848209 CTGGCTGCCCTTGAGGAAGAAGG - Intronic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1069751571 10:70748518-70748540 CAGGGTGAGGGTGGGGAAGAGGG - Intronic
1069833213 10:71293636-71293658 CAGGCTGGGCCAGAGGAAAAGGG - Intronic
1069883457 10:71608662-71608684 CAGCGTGGCCTTGAGGATAAGGG - Intronic
1069909601 10:71751332-71751354 CGGGGTGGGGTTGAGGGTGAGGG - Intronic
1069909624 10:71751400-71751422 CGGGGTGGGGTTGAGGGTGAGGG - Intronic
1069909647 10:71751468-71751490 CGGGGTGGGGTTGAGGGTGAGGG - Intronic
1069909670 10:71751536-71751558 CGGGGTGGGGTTGAGGGTGAGGG - Intronic
1070697684 10:78574905-78574927 CAGAGTGGGCTTGAGGCAGCTGG - Intergenic
1070744042 10:78922061-78922083 CAGGGAGGGGCTGAGGCAGATGG - Intergenic
1070955556 10:80461174-80461196 CAGGGTAGGCTGGAGGGAGCCGG - Intronic
1072484682 10:95843878-95843900 CAGGGTTGTCTTAATGAAGATGG - Intronic
1073126815 10:101155984-101156006 CAGGCTGGGGCTGGGGAAGATGG + Intergenic
1073426911 10:103460414-103460436 CAGGCTGGGCTTGGGGCAAATGG + Intergenic
1074319867 10:112392137-112392159 GTGGGTGGGATTGAGGCAGAGGG + Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1074819254 10:117166572-117166594 CAGGCTGGGCTGGCGGAAGGGGG - Intergenic
1075273208 10:121070921-121070943 AAGGGAGGGCTGGAGGAAGAAGG + Intergenic
1075638790 10:124049622-124049644 GAGGGTGGAGTGGAGGAAGAGGG + Intronic
1075967465 10:126625174-126625196 CAGCGTGGGCTTGAGGCTGACGG - Intronic
1075972279 10:126664892-126664914 CAGGGAGGGCTGGAAGAATATGG + Intronic
1077211930 11:1375159-1375181 CAGGCTGTGCTGGAGAAAGATGG - Intergenic
1077879004 11:6333083-6333105 CAGGGTGGGAAGGAGGTAGAAGG - Intergenic
1079029258 11:16973703-16973725 CAGGGTGGGCTCAAGGCATAGGG - Intronic
1079114492 11:17632555-17632577 CAGGGTGGTTTTGAGGATGTGGG + Intronic
1080216380 11:29846359-29846381 CGGGGTGGGGATGGGGAAGAGGG - Intergenic
1080451647 11:32383163-32383185 CAGGGAGGTCTGCAGGAAGAGGG - Intergenic
1081493514 11:43584077-43584099 CAGAGTGAGCCTGAGAAAGACGG - Intronic
1081726214 11:45331198-45331220 CATGGAGAGCTTCAGGAAGAGGG - Intergenic
1083275624 11:61595491-61595513 GAGGGGGGGGTTGGGGAAGAGGG - Intergenic
1084144036 11:67254452-67254474 CAGGGAGGGCTGGAGGCAGGGGG - Intronic
1084167275 11:67381391-67381413 CAAGGTGGGCCTCAGAAAGATGG - Intronic
1084269467 11:68021335-68021357 CAGGGTGGCAGTGAGGAACAAGG + Intronic
1084352151 11:68610031-68610053 CTGGGTGGGTTTGAGGAGGCGGG - Intronic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1085399638 11:76228025-76228047 CAATGTGGGCATGAGGAAGCAGG + Intergenic
1086002019 11:81995928-81995950 CACGGTGGACTTGAGTAAGTGGG - Intergenic
1088222947 11:107589365-107589387 CAGGGTAGGCTTCAGAGAGAAGG + Intergenic
1089012927 11:115145374-115145396 CAGGGTGGGCTGGAGGGACCTGG - Intergenic
1089500988 11:118931005-118931027 CAGGGAGGGCTTTGGGTAGATGG - Intronic
1089745839 11:120616182-120616204 CATGGTGGGGATGGGGAAGAGGG + Intronic
1090130033 11:124131297-124131319 CAGGGTGGGATTGAGCAGCATGG + Intronic
1090627748 11:128620727-128620749 CAGAGTTGGCTTCAGGAAAAAGG + Intergenic
1090651587 11:128811007-128811029 CAGGATGGGCTTCAGCTAGAAGG - Exonic
1090730393 11:129568681-129568703 CTGGATGGACTGGAGGAAGAAGG + Intergenic
1090754719 11:129779815-129779837 CAAGGTGGGGATGAGGGAGAAGG - Intergenic
1091536372 12:1413929-1413951 CAACGGGGGCTTGGGGAAGATGG + Intronic
1091856551 12:3745361-3745383 CACGGTGGGATTGAGGGAGGAGG - Intronic
1092030942 12:5284636-5284658 GAGGGTGGGGATGAGGAAGGGGG - Intergenic
1092407982 12:8234106-8234128 CAGGGTGGGCTTGGGGCATGGGG - Intergenic
1092654032 12:10666014-10666036 CAGGTTTGGCTTAAGGAAGGAGG - Intronic
1092821533 12:12357527-12357549 CAGGGCGGGCTGGAGGAGGGTGG - Intronic
1093662612 12:21774731-21774753 CAGGGAGGGCTAGAGGAAGGGGG + Exonic
1094144203 12:27211868-27211890 TAGGGTGGGATTGGGGTAGAAGG - Intergenic
1096477123 12:51915134-51915156 CAGGGTGGGGTTGGGGGAGAGGG - Intronic
1096837135 12:54358160-54358182 CAGGGTGGCCTTCAGGAATTAGG - Intergenic
1096919055 12:55064647-55064669 CAGGGTGGTTTTGAGAATGAAGG + Intergenic
1097247727 12:57615788-57615810 CAGGGAGGGCCTGAGGAATCTGG + Intronic
1097372009 12:58795560-58795582 AAGGCTGGGTTTGAGGAAGGAGG + Intronic
1097903911 12:64900816-64900838 CAGGGTGTGAGTGTGGAAGAGGG + Intergenic
1099466001 12:82988685-82988707 AAGGGTGGGCTGGAGGAAAGGGG - Intronic
1100315751 12:93442578-93442600 CAGGGTAGGCTGAAGGAAAAGGG + Intergenic
1100369018 12:93948415-93948437 CATGGTGGGCTGGAGGTAGAGGG - Intergenic
1100684146 12:96967271-96967293 CAGGGTGAACTAGAGGTAGAAGG - Intergenic
1101742815 12:107514208-107514230 CAAGGTGGGGTAGAGCAAGAGGG - Intronic
1102077679 12:110073144-110073166 CAGGGTGTGCCTGGGGAAGGTGG - Intronic
1102742870 12:115223549-115223571 CAGGGTGGCCTGGAGGAAGCTGG + Intergenic
1102766276 12:115436083-115436105 CAGGGAAGGCTTCATGAAGATGG + Intergenic
1103362223 12:120361330-120361352 CAGGGTTGGGTGGAGGAAGGTGG - Intronic
1103565709 12:121814357-121814379 CAGGGTGGGCTGGAGGGGGTGGG - Exonic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104856725 12:131905643-131905665 CAGGCTGGGCTGGAGGAGCAAGG - Intronic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1110648591 13:77918047-77918069 CATGGTGGGCTTGAGGAAGGGGG - Intronic
1111451990 13:88431242-88431264 CTGGGTGGGCCTGAGCAACAAGG - Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112036020 13:95497395-95497417 GTGGCTGGGCTTAAGGAAGAAGG + Intronic
1113044999 13:106146177-106146199 TGGAGTGGGCTTGGGGAAGAAGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113882878 13:113637470-113637492 CAGGATGGGCTGTGGGAAGAGGG + Intronic
1115161651 14:30403226-30403248 TAGGCTGAGTTTGAGGAAGATGG - Intergenic
1115389019 14:32832783-32832805 CAGGGTTGCCATGAGAAAGAGGG - Exonic
1115463323 14:33686109-33686131 CAGGCTGGCCTTGATGAGGAGGG + Intronic
1115573191 14:34686388-34686410 AAGGGTGAGAGTGAGGAAGAAGG + Intergenic
1117294956 14:54370782-54370804 CTGGGTGGGCTTCAGGATGTTGG - Intergenic
1117547508 14:56805309-56805331 GAGGGTGGGCATGGGGAAGAGGG + Intronic
1118739724 14:68730939-68730961 CAAGATGGGCTTGGGGAGGAAGG - Intergenic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1119390945 14:74290513-74290535 GAGAGGGGGCGTGAGGAAGATGG + Intronic
1119665868 14:76484596-76484618 AGGGGTGGGGTTGTGGAAGAAGG - Intronic
1119886992 14:78151664-78151686 CAGGGTGTGGTTCAGGAGGAAGG - Intergenic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1120409116 14:84129255-84129277 CAGGGAGGGCTGCAGGGAGAAGG + Intergenic
1121303661 14:92891489-92891511 CAGTTTGGGCTGGAGGAAGCTGG - Intergenic
1121321379 14:92993658-92993680 CAGGGTGCTCTTGCGGAAGGGGG - Intronic
1121447876 14:93989629-93989651 CCAGGTGGGCATGAGGAACAAGG - Intergenic
1121507127 14:94485932-94485954 GAGGGTGGGGGTGAGGGAGAAGG - Intergenic
1121858456 14:97292822-97292844 CAGGGTGGAATGGAGGCAGAAGG + Intergenic
1121882691 14:97514840-97514862 CCAGGAGGGCTTCAGGAAGAAGG + Intergenic
1122206934 14:100152309-100152331 CAGGGTGGGCATCATGGAGAAGG + Intronic
1122413047 14:101535735-101535757 GGGGGTGGGGCTGAGGAAGACGG - Intergenic
1122815993 14:104314345-104314367 CAGGCTGGGATGGAGGCAGATGG - Intergenic
1122887559 14:104717208-104717230 CCGGGGGGGACTGAGGAAGACGG - Intronic
1122887987 14:104719039-104719061 CAGGGTTGCCTTTAGGAAGCAGG - Exonic
1123970530 15:25504192-25504214 CAGGGTGGGGCAGAGAAAGATGG - Intergenic
1124271627 15:28287413-28287435 CAGGGTGGCTTTAATGAAGAGGG - Intronic
1124590286 15:31047605-31047627 CTGGGTGGGGTTGGGGAAGGGGG - Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1125089176 15:35770692-35770714 CAGGGTGGGGTTAAAGAAGAAGG + Intergenic
1125149763 15:36518644-36518666 AAGGTTGAGCTTCAGGAAGAAGG + Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1126098709 15:45106960-45106982 CAGGGTGCACCTGAGGGAGAGGG + Exonic
1126731954 15:51692450-51692472 CACTGTGGGCTTGGGGAAAAGGG + Intronic
1126918289 15:53490500-53490522 CAGGGTGGCCTAGAACAAGAGGG + Intergenic
1127642206 15:60926449-60926471 AAGGTTGGGGTTGAGCAAGATGG - Intronic
1127642508 15:60929265-60929287 GAGGGAGGGCTGGAGGAGGAGGG - Intronic
1128350525 15:66885431-66885453 CTGAGTGGGCTTTAGGGAGATGG + Intergenic
1128677920 15:69625256-69625278 CAGAGGGGGCTTGGGGAAGGGGG + Intergenic
1129050436 15:72777253-72777275 CAGTGAGGGCTTGAGTAAGGAGG + Intronic
1129604921 15:77020149-77020171 CAGGGTGGGCCTCAGGAAGCAGG + Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1130097713 15:80868229-80868251 CTGGGTGAGCTTGGGGAAGGTGG - Intronic
1130381913 15:83378966-83378988 CGGGGTGGGGGTGAGGAGGAGGG + Intergenic
1130612131 15:85371076-85371098 CTGGATGGGATTGAGGGAGAAGG + Intergenic
1131143099 15:89993506-89993528 TAGGGTGGGAATGAGGAGGATGG - Intergenic
1131251428 15:90833056-90833078 TGGGGTGGGCAAGAGGAAGAGGG + Intergenic
1131330191 15:91490934-91490956 GAGTGTGGGCTAGAGGAAGAGGG + Intergenic
1132552451 16:559186-559208 CAGGGGTGCCTTGGGGAAGAAGG - Intergenic
1132666456 16:1083278-1083300 CAGAGTGGGTGTGGGGAAGACGG + Intergenic
1132864499 16:2086732-2086754 CAGGGTGGCGATGTGGAAGACGG - Exonic
1133069017 16:3233579-3233601 CAGGCTTGGCTTGGGCAAGAAGG + Exonic
1133299810 16:4775434-4775456 CAAGGAGGGCTTCAGGGAGAAGG + Intergenic
1133723943 16:8520298-8520320 GAGGGTGGGGACGAGGAAGATGG - Intergenic
1134095887 16:11418087-11418109 GAGAGTGGGCCTGGGGAAGATGG + Intronic
1134190842 16:12120033-12120055 CTGGGTGGGCTAGGGGAGGAGGG + Intronic
1134517040 16:14895632-14895654 CAAGGCGGACTTGAGGAGGAAGG + Exonic
1135155551 16:20049931-20049953 CTGAGTGGGCTTGATGAATAAGG - Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1136135967 16:28257129-28257151 AAGGGTGGGTGGGAGGAAGATGG - Intergenic
1137662344 16:50219698-50219720 AAGGGAGGGATAGAGGAAGAGGG - Intronic
1138077688 16:54058483-54058505 CAGAGTGGGGCTCAGGAAGAAGG + Intronic
1138534202 16:57651342-57651364 CAGGGTGGGCTGCAGGGAAAGGG - Exonic
1138549737 16:57740827-57740849 GAGGGTGGGCTTCATGAGGAGGG - Intronic
1139093983 16:63682868-63682890 GAGGGTGGGCTGGAGACAGAAGG + Intergenic
1139392453 16:66613406-66613428 CTGGCTGGGCTCTAGGAAGAAGG - Exonic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140702043 16:77589761-77589783 GATAGGGGGCTTGAGGAAGAGGG + Intergenic
1140889337 16:79271837-79271859 CAGGGAGGTGATGAGGAAGAAGG + Intergenic
1141009641 16:80385536-80385558 CAGTGTGGGGTTGGGGAATAGGG + Intergenic
1141014487 16:80435711-80435733 CAAGGTGGGCTTAAAGATGAGGG - Intergenic
1141798567 16:86291580-86291602 CAGGGAGTGCATGAGGAAGCTGG + Intergenic
1141993575 16:87623354-87623376 CAGGGTGGGCGTGAGGCTCATGG + Intronic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1143033609 17:3982011-3982033 CAGGGAGTGCTTCAGGAAGGAGG + Intergenic
1143124988 17:4636264-4636286 CAGTGTGGGATGGAGGAAGCAGG - Intronic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143403525 17:6660893-6660915 CAGTGTGGGATGGAGGAAGCAGG + Intergenic
1143551025 17:7630606-7630628 CAGTGTGGGTTTGGGGGAGATGG - Intronic
1143720664 17:8806840-8806862 CATGGTGAGCTGGAGTAAGAAGG - Intronic
1143777983 17:9212086-9212108 CAGGTAGGGCTTGAGGGTGATGG + Intronic
1144620246 17:16814362-16814384 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144685608 17:17224054-17224076 CAGGCTGTCCTTGATGAAGAAGG + Exonic
1144737547 17:17563485-17563507 CAGGGTGCCCCTTAGGAAGAAGG + Intronic
1144812194 17:18007617-18007639 CAGGGTCGGCCTGAGGAACCTGG + Intronic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1145231676 17:21177704-21177726 CAGGGAGTGCTTGAGGCAGAGGG - Intronic
1146354903 17:32125749-32125771 CAGGGTGGACTTCAGGGAGGGGG - Intergenic
1146724844 17:35148452-35148474 CAGGGTGGGAGTGAGGCAGAGGG + Intronic
1147262757 17:39218132-39218154 GAGGATGGTCTTGAGGGAGAGGG + Exonic
1147571628 17:41575241-41575263 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1147638076 17:41976031-41976053 CAGTGTGGGTTCGAGGGAGATGG - Exonic
1147843566 17:43389347-43389369 CGGGGTGCTCTGGAGGAAGATGG + Intergenic
1147888102 17:43698167-43698189 CAGGGTGTGCTTGAGGCATGGGG + Intergenic
1147965720 17:44193343-44193365 CAGGGTGGGCAGGAGGAACACGG + Exonic
1148462622 17:47847206-47847228 TGGGGGTGGCTTGAGGAAGAGGG - Exonic
1148697964 17:49572460-49572482 CAGGGAAGGCTGGAGGCAGAGGG + Intergenic
1148737032 17:49870778-49870800 GAGGCTGGGATGGAGGAAGAAGG - Intergenic
1149352788 17:55808842-55808864 CTGGGTGGGGTTGAGGGGGAAGG - Intronic
1149453818 17:56771071-56771093 CAGGATGGTCTTGAGGCAGCTGG + Intergenic
1149544733 17:57495052-57495074 CAGGCTGGGCTGCAGGGAGAGGG + Intronic
1149647191 17:58249338-58249360 CACAGTGGGCTGGAGGGAGAGGG - Intronic
1149654513 17:58303139-58303161 CTGGGCGGGCTTGAGGCAAAGGG - Intronic
1150649169 17:66998778-66998800 CAGGGTGGGGGTGAGGAAGCAGG - Intronic
1151009816 17:70481788-70481810 CAGGGTTGGGTTGGGGAGGAGGG - Intergenic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152145736 17:78567703-78567725 CAGGGAGCGCTTCAGGGAGAGGG - Intronic
1152331969 17:79678750-79678772 AAGGCTGGGGTTGAGGAAGGAGG - Intergenic
1152407320 17:80105059-80105081 CAGGATGTCCTTGGGGAAGAAGG - Intergenic
1152640544 17:81447500-81447522 CCGGGTGCCCTTGAGGACGAGGG + Exonic
1153354575 18:4121310-4121332 CAGGATGGGCAAGAGGATGAAGG + Intronic
1153547262 18:6220477-6220499 CAGGGTGGGACTGAGCGAGAAGG - Intronic
1155229526 18:23758951-23758973 CATGGTAGGATTGAGGAGGATGG + Intronic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155777870 18:29791158-29791180 TAGGGTCTGCTTGAGGAAGGAGG - Intergenic
1156501646 18:37563906-37563928 AAGGGAGGGCTGGAGAAAGAGGG + Intronic
1156631461 18:38974387-38974409 CAGGGTGAGCTAGAGAGAGATGG + Intergenic
1156851818 18:41737528-41737550 GAGGGTGGGATAAAGGAAGAAGG - Intergenic
1158131924 18:54161746-54161768 AAGGGTGGTTTTGGGGAAGAGGG - Intronic
1158962985 18:62601701-62601723 CAGGGAGGGCCTCGGGAAGAAGG + Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1161196233 19:2988018-2988040 CAGGGTGGGGTAGAGGAGGTGGG + Intronic
1161320219 19:3637628-3637650 CCGGGTGGGCCGGAGGAGGAAGG + Intronic
1161612288 19:5250204-5250226 AAGGGTGTGCTCTAGGAAGAGGG + Intronic
1162152547 19:8656330-8656352 AGAGGTGGGCTTCAGGAAGAAGG - Intergenic
1162152556 19:8656366-8656388 GAAGGTGGGCTTCAGGGAGAAGG - Intergenic
1162194817 19:8976365-8976387 CAGGGTAGACTTCAGTAAGATGG + Exonic
1163161268 19:15465492-15465514 CAAGGGGGGCTTCTGGAAGATGG + Intergenic
1163307026 19:16486865-16486887 CAGAGTGGGTTTGAGTAAAATGG + Intronic
1163425852 19:17240671-17240693 CCGGGTGGGCATGAGGAAGGAGG - Exonic
1163799119 19:19354463-19354485 CAGGCTGGGGCTGGGGAAGAGGG - Intronic
1164592426 19:29513936-29513958 AAGGGAGGGTATGAGGAAGAAGG + Intergenic
1165355134 19:35299794-35299816 CAGGGTGGTGTTGGGGAAGGAGG - Exonic
1165385361 19:35507418-35507440 CAGGGTTGGCTTTAGGAGAAGGG - Intronic
1166675453 19:44738058-44738080 CAGGGTGGGCTTGAGAAGAGGGG + Intergenic
1166992153 19:46699082-46699104 CAGGGAGGGCGAGGGGAAGAGGG - Intronic
1167561143 19:50226757-50226779 CAGGATGGGGTTCAGGTAGAGGG + Intronic
1167580367 19:50337650-50337672 CAGGGTGGACTTGACGAAGAGGG + Intronic
1167583926 19:50362288-50362310 CAGGTTGGACTCGATGAAGAGGG + Exonic
1167586882 19:50380406-50380428 GTGGGTGGGCTTCTGGAAGAAGG + Intronic
1168186642 19:54704575-54704597 CAGGAGGGGCTTCTGGAAGATGG - Intergenic
1168199861 19:54806551-54806573 CAGGGTGGGCTTCTGGGAAATGG - Intronic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168326616 19:55541818-55541840 CAGGTTGAGGTTGAGGATGATGG - Intronic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
925314361 2:2909723-2909745 CAGGGGGTGCTGGAGGAAGTGGG + Intergenic
925710163 2:6731411-6731433 CAGGAGGGGCCAGAGGAAGAGGG + Intergenic
926059173 2:9794519-9794541 CAGTGAGGGATGGAGGAAGATGG - Intergenic
926198135 2:10775821-10775843 CCTGGTGGGCATGAGGAAGAAGG - Intronic
926335025 2:11856692-11856714 AAGGGAGAGCTTGAGGAAGGAGG + Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
926933350 2:18062566-18062588 CAGGGTGGGCTGCATGAAGCTGG + Intronic
926938194 2:18107255-18107277 CTGTGTGAGATTGAGGAAGAAGG + Intronic
927312953 2:21651058-21651080 CAGTGTGGGCTTGGGACAGAAGG - Intergenic
928340568 2:30439792-30439814 CAGGGTGGGGAGGAGGAAAACGG - Intergenic
929602274 2:43211825-43211847 CTGAGTGGGCCTGAGGAGGAAGG + Intergenic
929886642 2:45884392-45884414 CAGGGTGGTGGTGAGGAAGGAGG + Intronic
931415363 2:62075400-62075422 CAGGATGGGAGTGAGGAAGTGGG - Intronic
931430112 2:62202598-62202620 CAGGCTTGCATTGAGGAAGATGG + Intronic
931744756 2:65282167-65282189 GAGGGAGGGTGTGAGGAAGAGGG - Intergenic
932568088 2:72922006-72922028 CAGTGTGGGGCTGAGGAAGCAGG - Intronic
932774879 2:74522318-74522340 GAGGATAGGGTTGAGGAAGAGGG + Intronic
933223318 2:79716140-79716162 CAGGGTGGAGTTGTGGGAGAGGG + Intronic
933450182 2:82439197-82439219 AAGTGTGGGCTTCAGGAAAATGG - Intergenic
934661623 2:96146265-96146287 CAGGGCGGGCTTGTGGCAGGGGG - Intergenic
936022413 2:109004994-109005016 CAGACTGGGCCTGTGGAAGAGGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937338004 2:121074018-121074040 CAGGGCGGGCGTGGGGAAAAGGG + Intergenic
938141545 2:128798743-128798765 AAGGGTGGGCTTGGGGCTGAGGG + Intergenic
938444558 2:131367032-131367054 AGGGCTGGGCTTGAGGAGGAAGG - Intergenic
938697584 2:133848546-133848568 GAGGGTGGGGTGGAGAAAGAAGG + Intergenic
938838276 2:135130982-135131004 CAGGGAAGGCTTCATGAAGAGGG + Intronic
939745124 2:145958371-145958393 GTGGGTGGGGTTGGGGAAGAGGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
942448306 2:176092762-176092784 GAGAGAGGGCTAGAGGAAGAGGG + Intergenic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
942526888 2:176862235-176862257 GAGGATGGGTTTGAAGAAGATGG + Intergenic
942922106 2:181387481-181387503 CAGGGTGGTCATCAGGAAGTAGG + Intergenic
943770597 2:191712338-191712360 GAGGATGGGCTTGAGTAACATGG + Intergenic
943803274 2:192089248-192089270 TTGGGTGGGATTGAGGAAAAAGG - Intronic
943976347 2:194483686-194483708 CATGGTTGACTTGAGGAAAAGGG + Intergenic
944268868 2:197759452-197759474 CAGGGTGGGGTTGAGGGGGTGGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945163768 2:206920595-206920617 AAGGGTGGGCTGGAAGAGGAAGG + Intergenic
946026238 2:216673443-216673465 CAGGGCAGGCTGGAGGAAGGAGG + Exonic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
946216230 2:218185895-218185917 CAGTGTGGGCCTCAGCAAGAAGG - Intergenic
946961847 2:224993703-224993725 CAGAGTGGGCTTGGGGATGGAGG - Intronic
947669856 2:231929265-231929287 CAGGGTGGGCTTCCTGGAGAAGG + Intergenic
947816846 2:233043173-233043195 CAGGGTGGTCTTGGGGAACTGGG - Intergenic
949026267 2:241767831-241767853 CGGAGTGGGCTTCAGGAAGAGGG + Exonic
949058966 2:241945506-241945528 CAGGTGGGGCTTGGGGCAGAGGG + Intergenic
1169019340 20:2317319-2317341 CAGGGTGGGCGTGAGGACTCAGG - Intronic
1169656065 20:7924464-7924486 CATGCTGGGCTTGATGAGGAAGG + Intronic
1169907517 20:10618424-10618446 TAGGGTGGACATGAGGCAGATGG + Intronic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170206993 20:13809211-13809233 AAGGGTGCACTTGAGGATGATGG + Intronic
1172117153 20:32579852-32579874 CTGGGGGGGCTTTTGGAAGAAGG - Intronic
1172310889 20:33917697-33917719 CAGGGAGGGCATGAGGAAGTTGG + Intergenic
1172597324 20:36158384-36158406 CAGGGAAGGCTTCAAGAAGACGG + Intronic
1172628226 20:36360847-36360869 CAGGGTGGGTTTAGGGGAGAAGG + Intronic
1173731963 20:45335434-45335456 CAGGGTGGGAGTGGGGAAGGAGG - Intronic
1173863387 20:46298588-46298610 GTGGGTGGGCTGGAGGATGATGG + Intronic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174451589 20:50624192-50624214 CAGGGAGGGCAAGGGGAAGAGGG - Intronic
1175317398 20:58058617-58058639 CAAGGTGGGTTGGAGGATGACGG - Intergenic
1176032003 20:63017257-63017279 CAGGGTGGGCCTGAAGAAGGGGG + Intergenic
1176372323 21:6069517-6069539 CAGGCTGGGCTTCAGGAAGCAGG + Intergenic
1177317131 21:19476991-19477013 CTGGGGGGTCTTGAGGATGATGG + Intergenic
1177465215 21:21469222-21469244 CACGGTGAACTTGATGAAGAGGG + Intronic
1178007812 21:28242633-28242655 CAGGGCAGGGTAGAGGAAGATGG - Intergenic
1178490455 21:33047673-33047695 CAGGGAAGGCTTCAGGAAGGAGG + Intergenic
1179429829 21:41313356-41313378 CAGGGTGGTGTTGAGTAAGATGG - Intronic
1179553135 21:42156050-42156072 AAGGCTGGGCCTTAGGAAGAAGG - Intergenic
1179751195 21:43469022-43469044 CAGGCTGGGCTTCAGGAAGCAGG - Intergenic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180135222 21:45858013-45858035 CAGGGTGGGTCTGAGGAGCACGG - Intronic
1180589857 22:16928216-16928238 CAGGGAGGGTTCAAGGAAGATGG + Intergenic
1181316048 22:21971423-21971445 CAGGGTTGGCTGGAGGCAGGAGG + Intronic
1181801118 22:25348600-25348622 CAGGGTGGGCTGGCCGAAGCTGG + Intergenic
1181809512 22:25394940-25394962 CTGGGTGGGCTTGAGGACAGGGG - Intronic
1183394245 22:37562170-37562192 CAGGGTGGGGGTGAAGACGATGG - Intronic
1183679727 22:39320781-39320803 CAGGGTGGGACAGAGGAAGCAGG - Intergenic
1184291133 22:43498726-43498748 CTGGGTGGGGGTGAGGAAGTGGG - Intronic
1184512084 22:44939756-44939778 GAGGGTGGGTCTGAGGAAGAGGG + Intronic
1185020474 22:48371785-48371807 CCAGGTGGGCTTGAGGACCAGGG - Intergenic
1185323100 22:50210848-50210870 CAGGTGGAGCTGGAGGAAGACGG + Exonic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949474731 3:4432535-4432557 TAGGGAGGGATTGAGGAACAAGG - Intronic
950108308 3:10402312-10402334 CAGGGTGGGGCAGAGGATGAAGG - Exonic
950155457 3:10718298-10718320 CAGGGAGGGTTTTAGGAAAAGGG + Intergenic
950733083 3:14979737-14979759 CAGGGAGGGAGGGAGGAAGAAGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953808342 3:46090980-46091002 AAGGGTGGGCTGGAGCAAGGGGG - Intergenic
953846871 3:46434444-46434466 CATGTTGGGCTTGAGGCAGAGGG - Intergenic
954237430 3:49267561-49267583 CAGGGTGGGGGTGAGGAATGAGG - Intergenic
955786428 3:62545228-62545250 TAGGGTGGGGTGGGGGAAGAGGG - Intronic
955866282 3:63387974-63387996 CAGGCTGGGGCAGAGGAAGAAGG + Intronic
956080203 3:65549308-65549330 CTGGGCGGGAATGAGGAAGAGGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
958852695 3:99348169-99348191 CTGTGTGGGGTTGAGGAAAAGGG - Intergenic
958892399 3:99795548-99795570 CAGGCTGGCCTTGAGGACCAAGG - Exonic
958922842 3:100125443-100125465 AAGGGTGGGCTTGGGACAGATGG - Intronic
959201437 3:103252685-103252707 CAAGCTGGACTTGAGGCAGAAGG + Intergenic
959539405 3:107523254-107523276 TAGGGTGGACTTGAGGAAGACGG + Intronic
961008874 3:123423203-123423225 CAGCGTGGGCATGAGTAAGGAGG - Intronic
961011835 3:123441536-123441558 AAGGGTAGGCTTGTGGCAGATGG - Intronic
961438384 3:126935206-126935228 CAGGGCTGGCATGAGGCAGAGGG + Intronic
961612613 3:128152971-128152993 CGGGGTGGGCGGGGGGAAGACGG - Intronic
962871119 3:139493942-139493964 CATGGTGGGCATGAGCCAGAAGG + Intergenic
962941099 3:140125402-140125424 CCGGGTGGGCATGGGGAGGAGGG + Intronic
962989636 3:140566370-140566392 AAGGGTGGGCTCCAGGAAGCTGG - Exonic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
965604455 3:170484845-170484867 CAGGGTGGGCTGGAGGAGAGTGG + Intronic
965743419 3:171900479-171900501 CAGGCTGAGCTTGAGAAAGGCGG + Intronic
965774308 3:172212451-172212473 CAGGGATGGCCTGAGGAAGTTGG + Intronic
966199610 3:177348286-177348308 CAGGGTGGGCTGGGGGAAAGAGG + Intergenic
967115542 3:186334275-186334297 CAGGGTGGGGTGGGGGAATATGG - Intronic
967175077 3:186855409-186855431 CCAGGTGGCCTTGAGGAACAGGG - Exonic
968190923 3:196666525-196666547 GAAGGTGGACATGAGGAAGATGG + Intronic
968595621 4:1480922-1480944 CAGGGTGGGCTTGATGGATGAGG + Intergenic
968726884 4:2251964-2251986 CAGGGTGGGGTTGGGGCAGCGGG - Intronic
968762361 4:2449344-2449366 CAGGGTGGGTAGGAGCAAGAGGG - Intronic
968936274 4:3612128-3612150 CAGAGTGGGCTTGGGGAGCAGGG - Intergenic
968938843 4:3627580-3627602 TAGGTTGGGCTTGTGGGAGATGG + Intergenic
968996058 4:3946582-3946604 CATGGGGGGCTTGAGGCAGGAGG - Intergenic
971148269 4:24003442-24003464 GAAGATTGGCTTGAGGAAGAGGG + Intergenic
971500881 4:27316693-27316715 GAGGGTGGGATTGATGAAGGGGG + Intergenic
971663187 4:29447022-29447044 GAGGGTGGGTTTGAGGGAAAAGG - Intergenic
972284743 4:37637472-37637494 CAGGGCTGGCTGTAGGAAGAAGG - Intronic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
973773775 4:54228084-54228106 TGGGGTGGGGTTGAGGGAGAAGG + Intronic
976161329 4:82202156-82202178 CTTGGTGGGCTTGGGTAAGATGG - Intergenic
976401495 4:84611972-84611994 GTGGGCAGGCTTGAGGAAGAAGG + Intronic
978324737 4:107539576-107539598 CAGGGATGGGTTGAGGATGAGGG + Intergenic
978825927 4:113023408-113023430 CATGATGGGCATGAGAAAGATGG - Intronic
981078335 4:140613664-140613686 GAGGGTGGAGTTGAGGAGGAAGG + Intergenic
981403599 4:144341756-144341778 CCCGGTGGGCTTGAGCATGAGGG - Intergenic
983891449 4:173034276-173034298 TAGGGTGGCAGTGAGGAAGATGG - Intronic
985546893 5:514431-514453 CAGGGTGGGCCCCAGGAAGGGGG - Intronic
985933577 5:3078207-3078229 CAGGGTGGGCTTAGAGAAAAAGG + Intergenic
985948589 5:3205387-3205409 CAGGGTGGGCCAGAGCATGAGGG - Intergenic
986142045 5:5040150-5040172 CAGGGTAGGCTTTATTAAGAAGG + Intergenic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
988790698 5:34604775-34604797 CAGGGTTGCTTTAAGGAAGACGG + Intergenic
989130426 5:38101624-38101646 CTGGGAGGGGGTGAGGAAGAAGG + Intergenic
990159672 5:52923881-52923903 CAAGGTGGGCTCCATGAAGAAGG - Intronic
991072865 5:62504349-62504371 GAGCATGGGATTGAGGAAGAAGG - Intronic
991419776 5:66429075-66429097 CATAGTGGGCTTGAGATAGATGG - Intergenic
991680517 5:69134877-69134899 CGGGGTGGGTTGGGGGAAGAGGG + Intergenic
991966193 5:72093871-72093893 CAGGGTGGGAGTGTGGAAGAGGG - Intergenic
992495308 5:77287141-77287163 AAGGGTGGTCTTTAGAAAGAAGG - Intronic
993528876 5:89001170-89001192 CATAGTGGGCTTCAGGAACAAGG - Intergenic
994098034 5:95864977-95864999 CAAGGTGGGGTAGATGAAGAAGG + Intergenic
996952647 5:129146517-129146539 CAGAGTGGGCCTGAGGATGGGGG - Intergenic
997356018 5:133263442-133263464 GAGGGTAGGGCTGAGGAAGAAGG + Intronic
997711083 5:136005585-136005607 CATGGTGGGGTAGAAGAAGATGG - Intergenic
999393121 5:151208677-151208699 CACCCTGGGCTGGAGGAAGAAGG + Intronic
999397352 5:151238492-151238514 CAGGGTGAGCTGGAGGCAGCAGG - Intronic
1000052064 5:157572043-157572065 CAGGGTTGCCTTGAGCATGAAGG - Intronic
1001848709 5:174943902-174943924 CATGGGGAGCTTGAGGCAGAGGG + Intergenic
1002453647 5:179333176-179333198 CATGGGGGGCTTGAGGTGGAAGG - Intronic
1002707240 5:181170131-181170153 AAGGGTGGGGGTGAGGAACAAGG - Intergenic
1002918668 6:1549613-1549635 CTGGGTGGGGTTGAGGGAGATGG + Intergenic
1004573846 6:16873699-16873721 CAGGGATGGCTAGAGGGAGAAGG + Intergenic
1004902353 6:20206060-20206082 GAGGGTGGGCTTTGTGAAGAAGG - Intronic
1005266989 6:24122476-24122498 CAGGGTGTGTAAGAGGAAGATGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005841561 6:29747758-29747780 GAGGGTGGGGCTGAGGATGAAGG + Intergenic
1005881966 6:30068969-30068991 GAGGGTGGGCCTGGGGAAGCTGG + Intronic
1005911498 6:30313920-30313942 CTGGGTGTGCCTGAGGCAGAAGG - Intergenic
1006006617 6:31007583-31007605 CAGGGTGAGGTTGAGAGAGATGG + Intergenic
1006229956 6:32577463-32577485 CAGAGTGGGCCTGAGGCACATGG - Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1006894644 6:37459568-37459590 GAGGGTGGGATTGATGGAGATGG + Exonic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007315409 6:40984280-40984302 GAGGGTGGGCTTCAGAAACAAGG + Intergenic
1007590518 6:43017996-43018018 TAGGGTGGGACTGAGAAAGAGGG + Intronic
1009859812 6:69312646-69312668 CATGGTGGGGTGCAGGAAGAAGG - Intronic
1010157024 6:72806758-72806780 CGGGTTTGGCTTGAGGAAGTAGG - Intronic
1013163405 6:107567930-107567952 CAGAGTGGGTGTGTGGAAGAAGG + Intronic
1013177882 6:107692815-107692837 CAGGGTGGGGCTGCGGAACATGG + Intergenic
1013370859 6:109470035-109470057 GAGGGTGGGCTAGAGGCAGGAGG + Intronic
1013737263 6:113242288-113242310 CAGGATGGGGTAAAGGAAGAGGG - Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1015275014 6:131375344-131375366 GAGGCTGGGCTGGAGGAAGCTGG - Intergenic
1015507825 6:134007415-134007437 CCAGGTGGGCATGAGGAAGCCGG + Intronic
1016352656 6:143184615-143184637 CATGGTGGACATGAGGAAGCTGG - Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018148680 6:160918552-160918574 GAGCCTGGGCTTGAGGAAGGTGG - Intergenic
1018438308 6:163783201-163783223 CTGGGTGGGCTTCAGGAAGGAGG + Intergenic
1018723258 6:166589969-166589991 CAGGAAGGGCCAGAGGAAGAAGG + Intronic
1019064165 6:169282010-169282032 CAGGATGGGCTCCAGGAAGCAGG + Intergenic
1019162117 6:170075805-170075827 AAGGGAGGGCTGGAGGAAAAGGG + Intergenic
1019290156 7:246284-246306 CAGGGTGGCCCTGAGGAGGCTGG + Intronic
1019313457 7:373946-373968 GAGGGTGGGCAGGAGGGAGAGGG + Intergenic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019508594 7:1405745-1405767 GAGGGTGGGCTTGTGGCAGAGGG - Intergenic
1019649344 7:2148355-2148377 TGGGGTGGGCTTGCGGCAGAGGG - Intronic
1019817520 7:3211954-3211976 AAGGGCGGGCCTGAGGAAGGAGG + Intergenic
1020579945 7:9984528-9984550 TGGGGTGGGTTTGAGGAAAAGGG - Intergenic
1020727397 7:11832331-11832353 CAGAGGGGGCTGGAGGCAGAGGG + Intergenic
1021656631 7:22880207-22880229 CAGGATGGGCAAGAGGAAGCAGG - Intergenic
1022030606 7:26488460-26488482 CTGGGTGGGTTGGGGGAAGAAGG + Intergenic
1022547178 7:31200351-31200373 CAAGGTGGGGATGGGGAAGAGGG - Intergenic
1022650261 7:32267494-32267516 CAAGGAGGGCTTCTGGAAGAAGG + Intronic
1023000694 7:35804373-35804395 GAGCATGGGCTTGGGGAAGAGGG + Intronic
1023823010 7:43990473-43990495 CAGGGAGGGGCTGAGGAAGGAGG + Intergenic
1024366562 7:48527201-48527223 CAGGGTAGGCCTGGGGGAGACGG + Intronic
1024539803 7:50467002-50467024 CATGGCAGGCTTGAGGAAGCGGG + Intronic
1024883464 7:54115407-54115429 CAGGGTGAGCCTCAGAAAGAAGG + Intergenic
1026982037 7:74532601-74532623 CTGGGTGGGGCTGAGGAAGCAGG + Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1027196292 7:76032828-76032850 AAGGTTGGGCAAGAGGAAGAGGG + Intronic
1029751271 7:102543897-102543919 CAGGGAGGGGCTGAGGAAGGAGG + Intronic
1029769223 7:102643002-102643024 CAGGGAGGGGCTGAGGAAGGAGG + Intronic
1029982763 7:104894768-104894790 CAGGGTGGTTTTGAGGAATAAGG - Intronic
1030231115 7:107209244-107209266 CAGAGTGGGTTTGAGGAATAAGG + Intronic
1030607130 7:111649777-111649799 CAGCGTAGGATTGAGGAAGTTGG - Intergenic
1031091154 7:117356469-117356491 CTGGGTGGGATTGGGGATGATGG + Intergenic
1032299185 7:130670726-130670748 CTTGGGGGGCTTGAGGAAGGAGG - Intronic
1034116361 7:148587191-148587213 CAGGATGGGCAAGAGAAAGATGG + Intergenic
1034276994 7:149828208-149828230 CAGGCTGGGCTTGGGGATCAGGG + Intergenic
1034399424 7:150852362-150852384 GAGAGTGGGTTTGAGGAAGCTGG - Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1037832690 8:22198694-22198716 CAGAGGGGGCTTGAGGATGCAGG - Intronic
1037987523 8:23299199-23299221 CAGGGTGGGCCTTCGGAAGGGGG + Intronic
1038243621 8:25833102-25833124 CAGGGTTGGCTTGTTGATGAGGG - Intergenic
1038256082 8:25952579-25952601 CAGGTTGGGCATGAGCCAGAAGG - Intronic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1039378467 8:37061482-37061504 CAGGATGTGCTGGGGGAAGAGGG + Intergenic
1040306517 8:46214760-46214782 CACGGGGGTCTTGAGGAAGGGGG + Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1040572533 8:48623392-48623414 GAGTGTGGGCTGGAGGAATAGGG + Intergenic
1040900786 8:52414972-52414994 CAGGTTTGGCTGGATGAAGAAGG - Intronic
1041685289 8:60639012-60639034 AGGGGTGGGGGTGAGGAAGAAGG + Intergenic
1042458021 8:69028286-69028308 CAGGGAGGGGTGGAGGAAGTGGG + Intergenic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042668010 8:71228872-71228894 CAGGGTGGGTTGGAAGAGGAAGG - Intronic
1044630776 8:94276648-94276670 CAGCATGGGCTAGAGGCAGATGG + Intergenic
1045146277 8:99347836-99347858 CAGTGTGGGCTTTTAGAAGATGG - Intronic
1045639196 8:104228711-104228733 CAAGGTTGGCTTCATGAAGATGG - Intronic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1046300427 8:112278974-112278996 CAGGATACGCTTCAGGAAGAAGG - Intronic
1046593269 8:116230623-116230645 GAGGGTATGCTTGAGAAAGAAGG + Intergenic
1047292422 8:123541580-123541602 CGGGGTGGGCGTGAGGAGCAGGG + Intergenic
1048466116 8:134665873-134665895 CAGGCTGGGCTTGACACAGAAGG + Intronic
1049091243 8:140515463-140515485 CAGGGTGGGCCTGTCGAGGAGGG - Exonic
1049158781 8:141084311-141084333 CAGGGTGAGCTTGTGGCAGCAGG - Intergenic
1049191931 8:141293135-141293157 CTTTGTGGGCTTGAGGAAGCAGG - Intronic
1049298089 8:141854571-141854593 CAGGGAGGCCTAGAGGAAGTTGG + Intergenic
1050429188 9:5544460-5544482 GAGGGTGGACTGGAGGGAGAAGG - Intronic
1050610269 9:7344827-7344849 CAGGGAGGGGTGGAGGAAGGAGG + Intergenic
1051336480 9:16070573-16070595 CAGGGTGGGTGTGAGGAAGGAGG + Intergenic
1053679706 9:40476832-40476854 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1053929699 9:43105160-43105182 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054284014 9:63148113-63148135 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1054390806 9:64616843-64616865 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054504916 9:65899466-65899488 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1056801220 9:89693397-89693419 CAGTGTGAGGTTGAGTAAGATGG + Intergenic
1056803044 9:89707257-89707279 CACTGTGGGCTTCAGGAACAGGG + Intergenic
1057804761 9:98212148-98212170 GAGGGTGGGCTTGAGAAGGTGGG - Intronic
1057906767 9:98989452-98989474 CAGGGTGGCACTGAGGAAGCTGG - Intronic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1059431726 9:114254511-114254533 CGAGGTGGGCTTGGGGAAGTTGG + Intronic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1060103833 9:120861536-120861558 CAGGGAGGGCTTCAGGGAGGTGG + Intronic
1060116924 9:120949112-120949134 CAGGGTGGGCTTCAATGAGAAGG - Intergenic
1061178410 9:129010631-129010653 GGGGCTGGGCTCGAGGAAGAAGG - Intronic
1061396734 9:130347576-130347598 CAGGGAGGGCTTGAGGGGGCTGG + Intronic
1061925997 9:133806332-133806354 CAGGGTGTGATTCAGGTAGAAGG + Intronic
1062102914 9:134737818-134737840 CTGGGTGTGCTTGAGGCAGATGG + Intronic
1062165101 9:135103667-135103689 CAGGGTGGGCGGGATGAAGTGGG + Intronic
1185529565 X:806756-806778 CAGTGAGGGCTTGAGAAAGGGGG + Intergenic
1185978724 X:4750932-4750954 CAGAGTGGCCTGGAGAAAGAAGG - Intergenic
1186442666 X:9599459-9599481 CAGGGTGGGCTTGGTGGAGGAGG + Intronic
1186647653 X:11524455-11524477 CAGGGTGGGGTTGTGGGAGTGGG - Intronic
1187399418 X:18946624-18946646 TAGGGGGTGCTTGAGGAAAAGGG - Intronic
1187701657 X:21969235-21969257 AAGCCTGGGCTTGGGGAAGAAGG - Intronic
1188705276 X:33320615-33320637 CAGGGTGGGGTTGCTGAAGGTGG + Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190746103 X:53322275-53322297 CAGGGTTGGCTTCAGTAAGGTGG - Intergenic
1190924203 X:54887338-54887360 CAGGCTGGGTTTGATGAAGGAGG + Intergenic
1191255648 X:58278470-58278492 CAGGGGGAGGTTGAGGAAGCTGG - Intergenic
1191931350 X:66376454-66376476 CACGGTGGGCTTGAGTAGGCAGG - Intergenic
1192144472 X:68672229-68672251 CAGATTGGCCTTAAGGAAGAAGG - Intronic
1192147466 X:68691273-68691295 GAGTGAGGGCTTGAGGAAAAGGG + Intronic
1192180795 X:68914466-68914488 GAGGGTGGGCTAGGGGAAGGGGG + Intergenic
1192410746 X:70930533-70930555 CAGTGTGGGCTTGGTGAGGAGGG - Intronic
1194593085 X:95824560-95824582 GAGGTTGGGATGGAGGAAGAGGG + Intergenic
1195286752 X:103392946-103392968 GAGGGTGGAGTTGGGGAAGAGGG + Intergenic
1195704198 X:107726774-107726796 CATGGTGGGCCTGACCAAGAAGG + Intronic
1196051527 X:111310873-111310895 CTTGGTGGGCTTGTGGATGATGG + Intronic
1197172581 X:123450963-123450985 CTTGGTAGGTTTGAGGAAGAAGG + Intronic
1197255614 X:124259882-124259904 CATGATGGGCTGGAGGCAGAAGG + Intronic
1197733239 X:129829557-129829579 CAAGCTGAGCTTGATGAAGAGGG + Intronic
1199235712 X:145489743-145489765 CAGGGTGGGTTTGCCAAAGAAGG + Intergenic
1200056341 X:153463384-153463406 CAGGGAGGACTTGAGGATGTGGG - Intronic
1200141243 X:153904132-153904154 CAGGTGGGGCAGGAGGAAGAGGG + Intronic