ID: 1006672379

View in Genome Browser
Species Human (GRCh38)
Location 6:35737401-35737423
Sequence GACGCTGCAGGGTGGGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672379_1006672392 19 Left 1006672379 6:35737401-35737423 CCTCAAGCCCACCCTGCAGCGTC 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672379_1006672390 12 Left 1006672379 6:35737401-35737423 CCTCAAGCCCACCCTGCAGCGTC 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1006672379_1006672389 11 Left 1006672379 6:35737401-35737423 CCTCAAGCCCACCCTGCAGCGTC 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672379 Original CRISPR GACGCTGCAGGGTGGGCTTG AGG (reversed) Intronic