ID: 1006672382

View in Genome Browser
Species Human (GRCh38)
Location 6:35737409-35737431
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672382_1006672393 26 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672382_1006672392 11 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672382_1006672390 4 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1006672382_1006672389 3 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672382 Original CRISPR TTGCCTAGGACGCTGCAGGG TGG (reversed) Intronic