ID: 1006672383

View in Genome Browser
Species Human (GRCh38)
Location 6:35737411-35737433
Sequence ACCCTGCAGCGTCCTAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672378_1006672383 -6 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1006672374_1006672383 29 Left 1006672374 6:35737359-35737381 CCTCCAAGTTCCTCTTTCCTTTG 0: 1
1: 0
2: 5
3: 43
4: 445
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1006672376_1006672383 19 Left 1006672376 6:35737369-35737391 CCTCTTTCCTTTGTCTTTCTCTT 0: 1
1: 0
2: 48
3: 392
4: 3139
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1006672375_1006672383 26 Left 1006672375 6:35737362-35737384 CCAAGTTCCTCTTTCCTTTGTCT 0: 1
1: 1
2: 5
3: 70
4: 784
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1006672377_1006672383 12 Left 1006672377 6:35737376-35737398 CCTTTGTCTTTCTCTTGTCCATC 0: 1
1: 2
2: 7
3: 71
4: 817
Right 1006672383 6:35737411-35737433 ACCCTGCAGCGTCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672383 Original CRISPR ACCCTGCAGCGTCCTAGGCA AGG Intronic