ID: 1006672384

View in Genome Browser
Species Human (GRCh38)
Location 6:35737412-35737434
Sequence GCCTTGCCTAGGACGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672384_1006672389 0 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672384_1006672393 23 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672384_1006672392 8 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672384_1006672390 1 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672384 Original CRISPR GCCTTGCCTAGGACGCTGCA GGG (reversed) Intronic