ID: 1006672386

View in Genome Browser
Species Human (GRCh38)
Location 6:35737423-35737445
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672386_1006672392 -3 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672386_1006672390 -10 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672390 6:35737436-35737458 CTGCCAGAGATGCTAGCTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1006672386_1006672396 30 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672386_1006672393 12 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672386 Original CRISPR TCTCTGGCAGGGCCTTGCCT AGG (reversed) Intronic