ID: 1006672389

View in Genome Browser
Species Human (GRCh38)
Location 6:35737435-35737457
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672382_1006672389 3 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672381_1006672389 4 Left 1006672381 6:35737408-35737430 CCCACCCTGCAGCGTCCTAGGCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672384_1006672389 0 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672379_1006672389 11 Left 1006672379 6:35737401-35737423 CCTCAAGCCCACCCTGCAGCGTC 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672378_1006672389 18 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1006672385_1006672389 -1 Left 1006672385 6:35737413-35737435 CCTGCAGCGTCCTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1006672389 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type