ID: 1006672392

View in Genome Browser
Species Human (GRCh38)
Location 6:35737443-35737465
Sequence AGATGCTAGCTCAGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672379_1006672392 19 Left 1006672379 6:35737401-35737423 CCTCAAGCCCACCCTGCAGCGTC 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672384_1006672392 8 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672386_1006672392 -3 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672382_1006672392 11 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672385_1006672392 7 Left 1006672385 6:35737413-35737435 CCTGCAGCGTCCTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672381_1006672392 12 Left 1006672381 6:35737408-35737430 CCCACCCTGCAGCGTCCTAGGCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151
1006672378_1006672392 26 Left 1006672378 6:35737394-35737416 CCATCTTCCTCAAGCCCACCCTG 0: 1
1: 0
2: 5
3: 53
4: 545
Right 1006672392 6:35737443-35737465 AGATGCTAGCTCAGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672392 Original CRISPR AGATGCTAGCTCAGGGTCCC TGG Intronic