ID: 1006672393

View in Genome Browser
Species Human (GRCh38)
Location 6:35737458-35737480
Sequence GTCCCTGGATCTCACTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672391_1006672393 -4 Left 1006672391 6:35737439-35737461 CCAGAGATGCTAGCTCAGGGTCC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672387_1006672393 1 Left 1006672387 6:35737434-35737456 CCCTGCCAGAGATGCTAGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 149
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672386_1006672393 12 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672381_1006672393 27 Left 1006672381 6:35737408-35737430 CCCACCCTGCAGCGTCCTAGGCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672388_1006672393 0 Left 1006672388 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672384_1006672393 23 Left 1006672384 6:35737412-35737434 CCCTGCAGCGTCCTAGGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672385_1006672393 22 Left 1006672385 6:35737413-35737435 CCTGCAGCGTCCTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1006672382_1006672393 26 Left 1006672382 6:35737409-35737431 CCACCCTGCAGCGTCCTAGGCAA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1006672393 6:35737458-35737480 GTCCCTGGATCTCACTCAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672393 Original CRISPR GTCCCTGGATCTCACTCAAG TGG Intronic