ID: 1006672396

View in Genome Browser
Species Human (GRCh38)
Location 6:35737476-35737498
Sequence AGTGGATCCTCAGACTCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006672394_1006672396 -7 Left 1006672394 6:35737460-35737482 CCCTGGATCTCACTCAAGTGGAT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672386_1006672396 30 Left 1006672386 6:35737423-35737445 CCTAGGCAAGGCCCTGCCAGAGA 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672391_1006672396 14 Left 1006672391 6:35737439-35737461 CCAGAGATGCTAGCTCAGGGTCC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672388_1006672396 18 Left 1006672388 6:35737435-35737457 CCTGCCAGAGATGCTAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672395_1006672396 -8 Left 1006672395 6:35737461-35737483 CCTGGATCTCACTCAAGTGGATC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95
1006672387_1006672396 19 Left 1006672387 6:35737434-35737456 CCCTGCCAGAGATGCTAGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 149
Right 1006672396 6:35737476-35737498 AGTGGATCCTCAGACTCATCTGG 0: 1
1: 0
2: 0
3: 12
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006672396 Original CRISPR AGTGGATCCTCAGACTCATC TGG Intronic