ID: 1006679703

View in Genome Browser
Species Human (GRCh38)
Location 6:35788098-35788120
Sequence CACCATGAGTGGAGGGAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 260}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006679687_1006679703 22 Left 1006679687 6:35788053-35788075 CCTCCCTACCCAGAGCTCTGTGT 0: 1
1: 0
2: 3
3: 23
4: 292
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679690_1006679703 14 Left 1006679690 6:35788061-35788083 CCCAGAGCTCTGTGTTCACCCTG 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679693_1006679703 -5 Left 1006679693 6:35788080-35788102 CCTGTTCCCCAGAGCCTCCACCA 0: 1
1: 0
2: 3
3: 34
4: 431
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679692_1006679703 -4 Left 1006679692 6:35788079-35788101 CCCTGTTCCCCAGAGCCTCCACC 0: 1
1: 0
2: 5
3: 54
4: 417
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679691_1006679703 13 Left 1006679691 6:35788062-35788084 CCAGAGCTCTGTGTTCACCCTGT 0: 1
1: 0
2: 1
3: 27
4: 269
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679688_1006679703 19 Left 1006679688 6:35788056-35788078 CCCTACCCAGAGCTCTGTGTTCA 0: 1
1: 0
2: 2
3: 20
4: 246
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679689_1006679703 18 Left 1006679689 6:35788057-35788079 CCTACCCAGAGCTCTGTGTTCAC 0: 1
1: 0
2: 3
3: 18
4: 283
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260
1006679686_1006679703 30 Left 1006679686 6:35788045-35788067 CCTGCTCTCCTCCCTACCCAGAG 0: 1
1: 0
2: 4
3: 53
4: 504
Right 1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006679703 Original CRISPR CACCATGAGTGGAGGGAAGT GGG Exonic
900377030 1:2359544-2359566 CACCGTGGGTGGAGGCAAGATGG + Intronic
900650841 1:3729466-3729488 CACCATCAGTGTGGGGAAGGAGG + Intronic
901882427 1:12202115-12202137 CACCAGGCGTGGAGGCCAGTGGG + Exonic
902607584 1:17577332-17577354 CACCATGACTGGCCTGAAGTGGG + Intronic
902631728 1:17708733-17708755 CCCCAGGAGTGGAGCCAAGTGGG - Intergenic
902877136 1:19347492-19347514 GACCAGGTGTGGAGGGGAGTGGG - Intronic
904828845 1:33293944-33293966 GACCATGAGTGACGGGAAGGAGG - Intronic
905276711 1:36823110-36823132 CACCAGGAGTGAAGGGGAGATGG + Intronic
906949405 1:50322327-50322349 CACCCTGAGAGGAGGGCAGGTGG + Intergenic
907492289 1:54815908-54815930 CACCATGTGGGGAGGTAAGGAGG - Intronic
907611117 1:55872170-55872192 CTCCATGTGTGGAGGGAGGGAGG - Intergenic
909573309 1:77142783-77142805 CCCCATGTGTGGAGAGAAGGAGG - Intronic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911363686 1:96910870-96910892 CACCATGAGGCCAGGGAATTTGG + Intergenic
912688311 1:111784642-111784664 CACCATGGGTCAAGGCAAGTAGG - Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
916119027 1:161511777-161511799 GACCCTGAGTGCAGGGAAATGGG + Intronic
916128787 1:161593437-161593459 TACCCTGAGTGCAGGGAAATGGG + Intronic
916138701 1:161675268-161675290 TACCCTGAGTGCAGGGAAATGGG + Exonic
916148864 1:161766504-161766526 CACCACGAGTGGGCGGAAGTAGG - Intronic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
919598226 1:199590912-199590934 GACCAAGAGTGGTGAGAAGTGGG + Intergenic
920105718 1:203552024-203552046 GGCCATGAGGGGAGGGAGGTTGG - Intergenic
920441057 1:205980671-205980693 CACATCCAGTGGAGGGAAGTGGG - Intronic
920852882 1:209640592-209640614 CACAGTGAGTGGTGGGAGGTGGG - Intronic
921448408 1:215273545-215273567 CAGCATGAGATGAGGGCAGTAGG - Intergenic
921884110 1:220287286-220287308 CACAGTGAGTGGGAGGAAGTAGG - Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922191221 1:223320312-223320334 CATCATCAGGGGAGGGAAGGTGG + Intronic
922903266 1:229154814-229154836 CACAATGAGTGGAGGGGAAGAGG - Intergenic
1063158298 10:3399778-3399800 CAACAACAGTGAAGGGAAGTGGG - Intergenic
1063313925 10:4983616-4983638 CAGCATGGGTGGAGAGAATTAGG - Intronic
1063327864 10:5123084-5123106 CAGCATGGGTGGAGAGAATTAGG - Intronic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1067928984 10:50540669-50540691 CACCATGACTGGATTGAAGAGGG + Intronic
1069638862 10:69942262-69942284 CTCCATCAGTGCAGGGAGGTGGG - Intronic
1070159449 10:73857079-73857101 CACCATGGGGGCAGGGATGTAGG + Intronic
1070228597 10:74539445-74539467 CCCCATGAATTGAGGGAAATGGG + Intronic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1075092045 10:119449288-119449310 CGCCCTGAGTGGAGGCAGGTGGG + Intronic
1075657143 10:124169459-124169481 CACCATAATTGGAGGGTTGTCGG + Intergenic
1075723600 10:124600717-124600739 CCCCATGAGTGGAGGAATGATGG - Intronic
1076158441 10:128222159-128222181 AACCATAAGTGAAGGGCAGTGGG + Intergenic
1076841806 10:133049588-133049610 CACCATCAGTCAAGGGAAGAAGG - Intergenic
1077415635 11:2423093-2423115 CCCCCTGAGGGGAGGGAGGTGGG - Intergenic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1079591477 11:22188488-22188510 CACCATGGCTGGAGGGTAGTTGG + Intergenic
1080047884 11:27828231-27828253 CCCCATCAGTGGAGAGAACTGGG - Intergenic
1081756011 11:45545044-45545066 GACCATGAGAGGAGGGAGGGTGG - Intergenic
1083134288 11:60657080-60657102 CTCCATGAGGGGAGGGATGAGGG - Intergenic
1083225182 11:61280645-61280667 CACCATCTCTGGAGGGAATTGGG + Exonic
1085553998 11:77402937-77402959 CACCATAGGGGGAGGGAATTTGG - Intronic
1087548408 11:99614401-99614423 CACCACGAGTGGAGGGATGGTGG + Intronic
1088449875 11:109969942-109969964 CATCATGACTGGATGGAAATGGG - Intergenic
1089225026 11:116911991-116912013 CCATATGAGTGGAGCGAAGTTGG + Intronic
1089639630 11:119839219-119839241 CACCATGAGCTCAGGGAAGTGGG + Intergenic
1090313600 11:125765185-125765207 CACAATGAGTGGAAGGAACTAGG + Intergenic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1092909993 12:13138300-13138322 CACCATGAATGGTAGAAAGTGGG - Intronic
1094051818 12:26228452-26228474 CACCAACAATGGATGGAAGTTGG - Intronic
1094101998 12:26774886-26774908 AACCCTTAGTGGATGGAAGTTGG + Intronic
1094307958 12:29042147-29042169 TACCATGTGTGGAGGGCTGTGGG + Intergenic
1095865448 12:46966676-46966698 ACCCATGAGTGGAGGGAGGAGGG + Intergenic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1096789717 12:54037195-54037217 CACCCTCAGCGTAGGGAAGTAGG - Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1100138567 12:91586678-91586700 GACAATGGGTGAAGGGAAGTGGG - Intergenic
1100516155 12:95329813-95329835 CACCCAGACTGGAGGGCAGTGGG - Intergenic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1102551688 12:113696149-113696171 GGCCATGGGTGGAGGGATGTAGG - Intergenic
1103763520 12:123267108-123267130 CACCATCAGAGGAGAGAAGTTGG - Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1106507402 13:30383109-30383131 CACCAGGTGTGGTGGGAAGCAGG + Intergenic
1107384910 13:39897722-39897744 CACCATGAGTGGGAGGGAATTGG + Intergenic
1111222417 13:85221365-85221387 CCCCATGTGTCGAGGGAAGGAGG + Intergenic
1111796504 13:92927333-92927355 CACCCAGACTGGAGTGAAGTGGG - Intergenic
1112147444 13:96716870-96716892 CTCCATTAGTGTAGGTAAGTGGG + Intronic
1114635511 14:24184714-24184736 CTCCATGATGGCAGGGAAGTAGG + Exonic
1114689433 14:24566524-24566546 CAGCATGGTTGTAGGGAAGTGGG - Intergenic
1118987671 14:70770695-70770717 CACAATGATTGCAGGTAAGTTGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1121041987 14:90757208-90757230 GTCCATGAGTGGAGGGAACGGGG - Intronic
1121108110 14:91293793-91293815 CCCCCTGGATGGAGGGAAGTGGG - Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121586060 14:95063914-95063936 CACCAAGAATGGAGGAAAGCTGG + Intergenic
1123041913 14:105493750-105493772 CTCCATGAGTCCAGGGAGGTCGG - Intronic
1124852359 15:33352783-33352805 CACCATGAGTAAACAGAAGTGGG - Intronic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1127373459 15:58361181-58361203 CACCATGTGTGGTGGGCAGGTGG - Intronic
1127581552 15:60343417-60343439 CGCCACGTGTGGAGGGAAGGAGG - Intergenic
1131335102 15:91541360-91541382 CAGCTTGAGTTGAGGGCAGTGGG + Intergenic
1131465116 15:92648637-92648659 TACAATGAGTGTAGGGAGGTAGG + Intronic
1131977717 15:97961828-97961850 CATTTTGAGTGGAGAGAAGTGGG - Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1134562016 16:15219043-15219065 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1134922554 16:18130669-18130691 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1137405483 16:48185869-48185891 GACCATGAGATGGGGGAAGTAGG - Intronic
1138776914 16:59734438-59734460 CCCCATGTGTGGAGGGAGGGAGG + Intronic
1139837457 16:69850650-69850672 CAGCATGAGTGAAGGCAAGGAGG + Intronic
1141076760 16:81013401-81013423 CAAGAAGAGTGGAAGGAAGTGGG + Intronic
1141286992 16:82681831-82681853 CACCTGGAGTGCAGGGAAGTTGG - Intronic
1142848093 17:2691758-2691780 CACCTTGAGGGGCGGGATGTTGG + Exonic
1144135575 17:12291783-12291805 CCCCCTGAGTGGAGGGACCTTGG + Intergenic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148808142 17:50274423-50274445 CCCCATAGGTGGAGAGAAGTGGG + Intronic
1149295409 17:55257603-55257625 CACAATAAAGGGAGGGAAGTTGG + Intergenic
1149622078 17:58053205-58053227 CATCATGAGAGGAGGAAAGGTGG - Intergenic
1149946874 17:60937776-60937798 CACCTTGAATGGAGGTTAGTAGG - Intronic
1150230280 17:63545918-63545940 CACCATGAGGGGACTGAAGGTGG + Exonic
1151734772 17:75932416-75932438 AACCAGGAGCTGAGGGAAGTGGG + Intronic
1152928355 17:83098145-83098167 CCCCATAAGGGGAGGGGAGTTGG + Intergenic
1153010010 18:529896-529918 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1154374294 18:13796490-13796512 CCCCATGAGGGTATGGAAGTGGG + Intergenic
1157391430 18:47306836-47306858 CCCCATGATAGGAGGGAATTGGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157428663 18:47605169-47605191 CACCTTGAGTGGAGCCAAGCTGG + Intergenic
1157488184 18:48104311-48104333 CATCATGAGAGGAAGGAAGCAGG - Intronic
1157688754 18:49664088-49664110 CACTGTGAGTGGCTGGAAGTAGG - Intergenic
1157916115 18:51665311-51665333 CACCATGAGTGGGGGGAGACTGG - Intergenic
1161500848 19:4614640-4614662 CATCCTGAGTGGTGGGAAGAAGG - Intergenic
1162646056 19:12051483-12051505 CACCATGGCTGGAGTGCAGTGGG + Intronic
1163690842 19:18737366-18737388 CAGCATCAGTGGAGGCACGTGGG - Intronic
1163752445 19:19085789-19085811 CACCCTGAGGGGAGGGGAGAGGG + Intronic
1164529395 19:29036680-29036702 GACCATGACAGGAGGGAGGTCGG + Intergenic
1164582825 19:29445358-29445380 CCCAAAGAGTGGAGAGAAGTAGG - Intergenic
1164797595 19:31046586-31046608 CGCCATGAGTTGATGGATGTGGG - Intergenic
1166378755 19:42343745-42343767 GACCATGAGAGAAGGGAAGGAGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925703184 2:6659350-6659372 CACCATGAGTGAAGGGAGCCTGG + Intergenic
926001836 2:9339597-9339619 CACCATGAGGGAAGGGAATTTGG - Intronic
927149494 2:20187541-20187563 CACCATGTGGGGAGGGAGGCCGG - Intergenic
928848915 2:35718031-35718053 CCCCATGTGTGGAGGGAGGGAGG + Intergenic
930694205 2:54394700-54394722 CCCCATGTGTGGAGGGAGGGAGG - Intergenic
935151733 2:100443092-100443114 CACCATGTGTGGTGGGAATGAGG + Intergenic
935878032 2:107533810-107533832 CAAGATGAGAGGAGGCAAGTCGG - Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
942109956 2:172672030-172672052 CACCATGAGTTGGTAGAAGTGGG + Intergenic
942484942 2:176429036-176429058 CCCCACGTGTGGAGGGAAGGAGG + Intergenic
945181595 2:207097277-207097299 CTTCATGAGTATAGGGAAGTGGG - Intronic
945738157 2:213627088-213627110 CACCATCTGTGGATGGCAGTGGG + Intronic
945930523 2:215850433-215850455 AACCAGGAGTGGTCGGAAGTGGG - Intergenic
946159355 2:217826673-217826695 CTCCAGGATTGGAGGGAAGGAGG - Intronic
946362207 2:219225780-219225802 TACCATGAGGTGAGGAAAGTAGG - Intronic
947463377 2:230322017-230322039 CACCAGGAGTGGAGAGAACCTGG - Intergenic
948335665 2:237205073-237205095 CACCAAAAGTGGAGGGAGGGAGG + Intergenic
948757053 2:240165964-240165986 CTCCATGTGTGGAGGGAGGGAGG + Intergenic
1169359904 20:4939194-4939216 CACCAGGGGTGGAGGTAAGATGG - Intronic
1169943043 20:10958208-10958230 CACCATGTGTTTAGAGAAGTTGG - Intergenic
1171201893 20:23248272-23248294 AAACATGAGTGGTGTGAAGTAGG - Intergenic
1172006803 20:31823498-31823520 CACCATGCGGTGAGGGAAGGGGG - Exonic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1173791114 20:45828359-45828381 AATCCTGACTGGAGGGAAGTTGG + Intronic
1174371252 20:50089683-50089705 TACCATGAATGGTGGGAAGAGGG - Intronic
1174556345 20:51398160-51398182 AACCTTGAGTGGAGGGAATCAGG + Intronic
1175644908 20:60662879-60662901 CAGCATGAGTGAAGGCAAGCAGG + Intergenic
1175876694 20:62233412-62233434 CACCCTGACTGATGGGAAGTGGG - Intronic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
1176977631 21:15340628-15340650 CCCCATGTGTCGAGGGAAGGAGG + Intergenic
1180157628 21:45985811-45985833 CACCAACTCTGGAGGGAAGTGGG - Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1183247351 22:36703828-36703850 CACCAAGGGGGGAGGGAAGGGGG - Intergenic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
1183623151 22:38986533-38986555 CACCAGGAGTTAAGGGAAGGTGG - Intronic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
1185252250 22:49809692-49809714 CACCATGACTGGAGTGAAGAGGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
952368025 3:32692070-32692092 CACCATGCCTGGCGGGAAATTGG - Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
955561531 3:60196294-60196316 CACCATGAGGTGAGGAATGTGGG - Intronic
956374030 3:68594990-68595012 GGCCATGAGTGAAGGGATGTGGG - Intergenic
957277193 3:78105835-78105857 CTGCATGAGTGGAAGAAAGTAGG + Intergenic
959343057 3:105156200-105156222 AACCAATAGTTGAGGGAAGTGGG - Intergenic
959604029 3:108222464-108222486 CGCCCTGATTGGAGGGAAGGAGG - Exonic
960534574 3:118802365-118802387 CCCCATGAGTTGTGGGAATTAGG - Intergenic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
963773078 3:149409311-149409333 CACCATGAAAGGAGAGAAGCTGG - Intergenic
964309910 3:155381440-155381462 CACCTTGAATGGTGGTAAGTGGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966149009 3:176845553-176845575 TACTTTGAGTGAAGGGAAGTAGG - Intergenic
967516276 3:190372601-190372623 CACCAAGGCTGGAGGGTAGTAGG - Intronic
969301569 4:6300309-6300331 GACCCTGAGGGGAGGGAAGTGGG + Intronic
969850152 4:9949664-9949686 CACCATGAGGGAAGGGAAGGTGG - Intronic
971289854 4:25327518-25327540 CACCCAGATTGGAGGGCAGTGGG + Intronic
972375764 4:38468793-38468815 TACCATGAGTGTTGGGAGGTTGG - Intergenic
973329444 4:48897377-48897399 GACCATTAGTGGAGGAATGTGGG - Intronic
973711212 4:53632060-53632082 GACCTGGAGTGGAGGGAGGTGGG + Intronic
978081556 4:104599200-104599222 CCCCATGTGTCGAGGGAGGTAGG + Intergenic
978951943 4:114571396-114571418 CTCCATGAGTGGAGGGACTTTGG - Intergenic
981335210 4:143561773-143561795 CACCATGGCTGGAGTGTAGTGGG + Intergenic
982087098 4:151846702-151846724 GCCCATGAGTTGAGGGAAGTAGG + Intergenic
984860872 4:184236832-184236854 CACCCTCAGTGGAGAGGAGTGGG - Intergenic
984998844 4:185465024-185465046 TACCATGAAAAGAGGGAAGTAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986303835 5:6500919-6500941 CACTATGAGGGGTGGGACGTTGG - Intergenic
986424561 5:7617746-7617768 CACCAGGAGAGGAAGGAAGGTGG + Intronic
987639188 5:20589660-20589682 CACCAGGAGAGGAGAGAACTAGG - Intergenic
988412485 5:30904925-30904947 TACCATGAATGGAAGGAAGCAGG + Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
995989827 5:118223932-118223954 CCCTATGTGTCGAGGGAAGTGGG - Intergenic
996347076 5:122499028-122499050 CACCTTGAGGGGAGAGAGGTAGG - Intergenic
997584676 5:135037318-135037340 CACGAAGAGAGGAGGGAAGGGGG + Intronic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
998525153 5:142836130-142836152 AAACATTAGAGGAGGGAAGTGGG - Intronic
999231178 5:150062938-150062960 CATCATGGCTTGAGGGAAGTGGG + Intronic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1004248820 6:14005463-14005485 GAACATGAGTGGAGGGAGATAGG + Intergenic
1004973286 6:20935884-20935906 CACCAAGAGTGTGGGGAAGCAGG - Intronic
1005091663 6:22063150-22063172 CTCCGTGGGTGAAGGGAAGTGGG - Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1006758943 6:36442665-36442687 CCCCATGCGTGGAGCGAGGTTGG - Exonic
1006930284 6:37683654-37683676 CACCATGGGGTGAGGGAACTAGG - Intronic
1007372647 6:41436699-41436721 CACCTTTAGAGGAGGTAAGTGGG - Intergenic
1007610503 6:43145874-43145896 CACCCTGAGTGGAGAGGAGAAGG - Intronic
1008056991 6:46955505-46955527 CACCATCCGTGGAGTGAAGTAGG + Intergenic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1008878525 6:56355752-56355774 AACCATGAGTTGAGGGTTGTTGG + Intronic
1012803700 6:103868635-103868657 CACCATGTGTGGAGGGAGGGAGG - Intergenic
1013671295 6:112406281-112406303 CTCCAGGAGTGGAGGGGTGTAGG + Intergenic
1013783134 6:113750612-113750634 CACAATGAGTGGATAGAACTGGG - Intergenic
1016793707 6:148094983-148095005 CACTATGGGGGTAGGGAAGTTGG + Intergenic
1019290502 7:247848-247870 GACCAGGTGTGGAGGGACGTGGG - Intronic
1022446066 7:30471748-30471770 CCCGAAGAGTGGAGGGAGGTTGG - Intronic
1022798505 7:33752699-33752721 CACCATGGCTGTAGGGCAGTGGG - Intergenic
1022860010 7:34357987-34358009 CACCACGAGTGGAGGGCTTTGGG - Intergenic
1023754962 7:43407798-43407820 CTCCATGAATGGAGGGAAGGAGG - Intronic
1023805896 7:43872696-43872718 CACCATGAGTGGAGTGATATCGG - Intronic
1027162810 7:75814720-75814742 CACCAAGATTCTAGGGAAGTGGG + Intronic
1028527550 7:91802071-91802093 TACCATGAGTGGAGGGGAGGAGG - Intronic
1029312807 7:99683301-99683323 CCCTATCAGTGGAGAGAAGTAGG + Intergenic
1029320629 7:99756330-99756352 CCCTATCAGTGGAGAGAAGTAGG + Intergenic
1030380474 7:108805022-108805044 CACCACGTTTGGTGGGAAGTGGG - Intergenic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1032225876 7:130031350-130031372 CACCATGATTGTGGGGATGTTGG - Intronic
1033591157 7:142809403-142809425 TTACATGAGTGGAAGGAAGTGGG - Intergenic
1034089401 7:148350048-148350070 GACCATGAGTGGAGGCAGGGAGG + Intronic
1034089527 7:148351202-148351224 GACCATGAGTGGAGGTAGGGAGG + Intronic
1034683815 7:152952160-152952182 CACCAAGAGTGGGTGGAGGTGGG - Intergenic
1034895328 7:154872669-154872691 CACCAGGAGCAGAGGGTAGTGGG - Exonic
1037760597 8:21739070-21739092 CCCCATGGATGGAGGGAAGAAGG + Intronic
1038303287 8:26375974-26375996 CACCCAGACTGGAGGGCAGTAGG + Intergenic
1038674966 8:29615211-29615233 CACCATGTGAGGAGAGAAGAAGG - Intergenic
1038702163 8:29858958-29858980 CACCATGAGCTGAGGACAGTGGG - Intergenic
1039475650 8:37838066-37838088 CCCCATGAGTGGTGGGATGTGGG + Intronic
1042684920 8:71427546-71427568 CACAATGAGGTGAGAGAAGTAGG - Intronic
1044208725 8:89523501-89523523 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1045172714 8:99688052-99688074 CAGCATGGGTTGGGGGAAGTGGG + Intronic
1047097666 8:121641526-121641548 AACCCTGAGGGGAGGGAACTGGG + Intergenic
1047422199 8:124716506-124716528 CACCAGGAGTAGGTGGAAGTGGG - Intronic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1049023931 8:139975732-139975754 CAGCTTGAGTGGGGTGAAGTTGG - Intronic
1049331878 8:142058975-142058997 CACCCTGAGTGGAGGCAGCTGGG - Intergenic
1051608454 9:18939148-18939170 CACGATGGGTGGAGGGAATAAGG - Intronic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1054831692 9:69632331-69632353 CACCTTTGGGGGAGGGAAGTTGG - Intronic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1056040299 9:82658880-82658902 CACCATGGGAGGTGGGAGGTGGG - Intergenic
1056581916 9:87894774-87894796 CACCGGGAGTGGGGGGAAATTGG + Intergenic
1056802742 9:89704661-89704683 CACCAGCAGTGGATGGAGGTTGG - Intergenic
1057400354 9:94717917-94717939 CCCCATGTGTGGAGGGAGGGAGG - Intergenic
1058083392 9:100722772-100722794 TACCATAATTAGAGGGAAGTGGG + Intergenic
1058308625 9:103473182-103473204 AGCCATGACTGGAGGGAGGTAGG + Intergenic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1059261680 9:112983129-112983151 AACCATGATTGCAGGGATGTAGG - Intergenic
1059603243 9:115804276-115804298 CACCCTGGCTGGAGTGAAGTGGG - Intergenic
1060124174 9:121025979-121026001 CACAATGAGTAAAGGGATGTGGG + Intronic
1060389298 9:123266155-123266177 CACCAAGAGTGAATGGAAATGGG - Intronic
1061701950 9:132422777-132422799 CACCTTCAGTAGAGGGAAGGAGG - Intronic
1062302788 9:135884891-135884913 GCCCATGGGTGGAGGGAACTTGG - Intronic
1186690489 X:11970094-11970116 CACCAAGAGTGTAGGCAATTTGG + Intergenic
1187157286 X:16732856-16732878 CCCCATGAGTGCAGGGACCTGGG - Intronic
1188106672 X:26155588-26155610 CCCCATGTGTGGAGGGCAGGAGG - Intergenic
1195204441 X:102582201-102582223 CACCATGAGTGTACTGAAGCTGG + Intergenic
1196309913 X:114151672-114151694 CCCCATGTGTTGAGGGAAGGAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1198619319 X:138488901-138488923 CACCTTGAGTGGAGGCAGGCCGG + Intergenic
1201567922 Y:15385807-15385829 CCCCATGTGTGGAGGGAGGGAGG + Intergenic