ID: 1006679769

View in Genome Browser
Species Human (GRCh38)
Location 6:35788371-35788393
Sequence GTGTAAACTGGGCTTCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006679769_1006679780 25 Left 1006679769 6:35788371-35788393 CCCCCCGGAAGCCCAGTTTACAC No data
Right 1006679780 6:35788419-35788441 AATTTCAGAAATGTGAAAGAAGG 0: 1
1: 0
2: 5
3: 92
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006679769 Original CRISPR GTGTAAACTGGGCTTCCGGG GGG (reversed) Intronic