ID: 1006683719

View in Genome Browser
Species Human (GRCh38)
Location 6:35815072-35815094
Sequence CGCCTCAGTGCCTCCTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006683719_1006683728 20 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683728 6:35815115-35815137 TGGAAGTTTGTTGGTGGAGATGG No data
1006683719_1006683726 14 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683726 6:35815109-35815131 TATTCCTGGAAGTTTGTTGGTGG 0: 1
1: 0
2: 2
3: 15
4: 217
1006683719_1006683725 11 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683725 6:35815106-35815128 TAATATTCCTGGAAGTTTGTTGG 0: 1
1: 0
2: 2
3: 20
4: 208
1006683719_1006683730 22 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683730 6:35815117-35815139 GAAGTTTGTTGGTGGAGATGGGG No data
1006683719_1006683729 21 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683729 6:35815116-35815138 GGAAGTTTGTTGGTGGAGATGGG No data
1006683719_1006683724 0 Left 1006683719 6:35815072-35815094 CCCTAGAAGGAGGCACTGAGGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1006683724 6:35815095-35815117 GGGTCTCGAAGTAATATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006683719 Original CRISPR CGCCTCAGTGCCTCCTTCTA GGG (reversed) Intronic
900712417 1:4122711-4122733 TGCCTCAGCGCCTGCTTCAAGGG - Intergenic
901677011 1:10891332-10891354 CACCTCAGTGCCTCCTCCTTAGG + Intergenic
901864732 1:12097234-12097256 CTCTCCAGGGCCTCCTTCTAGGG + Intronic
903122629 1:21226135-21226157 CTCCTCATTGCCTCCTTCCTTGG - Intronic
903694094 1:25194905-25194927 AGCCTCGGTGTCTCCTTCTGTGG - Intergenic
904824387 1:33265223-33265245 AGCCTCAGTGCCCTCATCTAGGG - Intronic
905927373 1:41761032-41761054 GGCCTCAGTGCCTCCATGTCTGG - Intronic
906249853 1:44302574-44302596 TGCCTGAGAGCCTCCTTCCAGGG - Intronic
908845800 1:68323151-68323173 CCCCTCAGTTCCTCCTCCCAGGG + Intergenic
914419759 1:147518625-147518647 CACCTCAGGGTCTTCTTCTAAGG - Intergenic
919675881 1:200382570-200382592 GGGCTCAGAGCCTGCTTCTAGGG + Intergenic
924449225 1:244162668-244162690 AGCCTCAGTTCCTCCTTATTTGG + Intergenic
1062898899 10:1126621-1126643 TGCCTCTGTGGCTCCTTCTGTGG + Intronic
1062906444 10:1182868-1182890 CGTGTCGGTGCCTCCTTCCAAGG + Exonic
1063075522 10:2712787-2712809 TGCCTCACTGCTTCCTGCTAGGG - Intergenic
1064359954 10:14655632-14655654 TGCCTCAGGGTCTACTTCTAAGG - Intronic
1064987120 10:21221959-21221981 AGCCTCACTACCTCCTTCTAGGG - Intergenic
1068520932 10:58077091-58077113 CATCTCAGGGCCTGCTTCTAGGG - Intergenic
1070811174 10:79298808-79298830 CGCCTCCTTGCATCCTTCCATGG - Intronic
1074145088 10:110710559-110710581 CGCCTCAGTCCTTCCTACTGGGG - Intronic
1075713422 10:124542711-124542733 CACCTCTCTGCCTCCTTCCAGGG + Intronic
1076540795 10:131213564-131213586 CGCCTCAGTGTCCCCGTCTATGG + Intronic
1077378733 11:2217965-2217987 CTCCTCAGTGACTCGTTCTCAGG + Intergenic
1083737812 11:64691654-64691676 CCTCTCAGTGCCTGGTTCTATGG - Intronic
1085088696 11:73691181-73691203 CACCCCAGAGCCCCCTTCTAAGG - Intronic
1086431708 11:86742684-86742706 CACCTCCATGCCTCCCTCTAAGG + Intergenic
1089013043 11:115145909-115145931 TGCCTCAGTGCCTGCATCTATGG + Intergenic
1091690372 12:2592344-2592366 TGCCTCAGTTTCTCCATCTAAGG - Intronic
1093429321 12:19066111-19066133 TAACTCAGTTCCTCCTTCTATGG + Intergenic
1094224364 12:28028551-28028573 CTGCTCAGAGCCTCGTTCTAGGG - Intergenic
1103167911 12:118786188-118786210 GGCCTCAGTTCCTCTTTGTATGG - Intergenic
1104085749 12:125472724-125472746 CTTCTCAGTGCCTCCTTACATGG - Intronic
1104411574 12:128562579-128562601 AGCTGCAGTGCTTCCTTCTAAGG - Intronic
1105830962 13:24162359-24162381 TGCCTCAGTGCCTTCTGCTGCGG + Intronic
1111962756 13:94829339-94829361 TGCCTCAGTGCCTCATTCTCCGG + Intergenic
1113467430 13:110522165-110522187 TGCCTCAGTGCTTCCTCCTGGGG + Intergenic
1117400674 14:55356054-55356076 CGGCTCAGAGCCTGCTGCTAGGG - Intronic
1117988052 14:61407988-61408010 CACCTCTATGCCTCCTTCTCTGG + Intronic
1121680154 14:95786986-95787008 TGCCTTAGGACCTCCTTCTATGG + Intergenic
1121694341 14:95900578-95900600 GGGCACAGTGCCTCCTTCTTAGG + Intergenic
1122652474 14:103232962-103232984 CGCCTCAGTGCCTTCTGATCCGG - Intergenic
1132391267 15:101439866-101439888 AGCCTTGGTGGCTCCTTCTAGGG - Intronic
1132473164 16:118127-118149 CGCCTCAGAAACTCCTTCCATGG + Intronic
1133454251 16:5929216-5929238 CACCTCTGTGCCACTTTCTAAGG + Intergenic
1136059691 16:27718069-27718091 TGCCTCAGGGTCTGCTTCTAGGG + Intronic
1137943483 16:52711939-52711961 CCCCTCAGTGGCTTCTGCTATGG - Intergenic
1138520040 16:57565840-57565862 AGCCTCAGTGCCTCCATTTCTGG + Intronic
1141096267 16:81165267-81165289 AGCCTCAGTTCCTCCTGCCAGGG - Intergenic
1141890121 16:86920642-86920664 CTCCTCAATGCCTACTACTAGGG - Intergenic
1142409970 16:89910997-89911019 CTCCACAGTGCCTCCTGCTTGGG + Intronic
1143281934 17:5761299-5761321 TGTCTCAGTGTCTGCTTCTAGGG - Intergenic
1143492002 17:7290149-7290171 ACCCTCAGTTCCTCCTTCTTTGG + Intronic
1143702999 17:8675368-8675390 CGCTTCAGTGCCCCCTTCCTGGG - Intergenic
1146588199 17:34101260-34101282 AGGCTCAGTCCCTCCTTCAAGGG + Intronic
1148076098 17:44935977-44935999 GGCCTCCCTGCCTCCTCCTAAGG - Intronic
1148222361 17:45872011-45872033 CAGCTCAGGGGCTCCTTCTATGG - Intergenic
1154017565 18:10632976-10632998 CACCTCAGTTTCTCCATCTAAGG + Intergenic
1154187300 18:12196622-12196644 CACCTCAGTTTCTCCATCTAAGG - Intergenic
1155648592 18:28112450-28112472 CACCTCGGTGCCTCCTTCAAAGG - Intronic
1157434903 18:47660035-47660057 CTCCTTACTGTCTCCTTCTATGG - Intergenic
1158962325 18:62596952-62596974 TGCCTCCGTGCCTCCCTCTCCGG - Intergenic
1158971588 18:62673111-62673133 CTCCTCACTGTCTCCTTCTTAGG + Intergenic
1160738466 19:675346-675368 CCCCTCTGTTCCTGCTTCTAGGG - Intergenic
1162439413 19:10683323-10683345 TGACTCAGTGCCTCCCTCCAGGG - Intronic
1163519144 19:17781571-17781593 GGCCTCAGTGTCACCTTCTCTGG + Intronic
1164486324 19:28658551-28658573 AGGCTCATTGCCTCCTTCTCTGG - Intergenic
1167095590 19:47373449-47373471 AGCCCCAGTGCCCCCTCCTATGG - Intronic
1167408972 19:49333925-49333947 AGGCTCAGTGCCTCCTCCTCTGG + Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925406235 2:3606884-3606906 CGGCACAGTGCCAGCTTCTAAGG + Intronic
927149646 2:20188300-20188322 CTCTTCAGTGCCTCCCTCCAGGG + Intergenic
928116873 2:28551391-28551413 CACCTCAGTCCCCCCTTCTCTGG - Intronic
929091057 2:38217739-38217761 ATCCTCAATGCCTCCTTCAAAGG + Intergenic
930217399 2:48710709-48710731 TGCCTCAGGGCCACCTTCTGCGG + Intronic
931090323 2:58878891-58878913 CTCCTCAGTGACTCCTACCATGG + Intergenic
937193939 2:120133336-120133358 CTCTTCAGTGCCTCCTTCCTTGG - Intronic
941989522 2:171541417-171541439 CCTCTCAGTGGCTCCCTCTAGGG - Intronic
942902848 2:181144194-181144216 TGCCACAGTGCCTCCTACTGTGG + Intergenic
943375835 2:187075485-187075507 TGTCTCAGTCCCTGCTTCTAGGG + Intergenic
948624516 2:239260871-239260893 GGCTTCCGTGCCTCCTTCTCAGG - Intronic
1168981116 20:2004520-2004542 CACCACACTGCCTCTTTCTATGG - Intergenic
1169374702 20:5057154-5057176 CGCCTCAGGCTCTGCTTCTAGGG + Intergenic
1169450463 20:5706435-5706457 TGCCTCAGAGTCTGCTTCTAGGG + Intergenic
1173518517 20:43682289-43682311 CCCCTCAGGACCTCCTTCTCAGG + Intronic
1173556838 20:43972462-43972484 TGCCTCAGGCTCTCCTTCTAGGG + Intronic
1175293052 20:57891053-57891075 ACCCCCAGTGTCTCCTTCTATGG + Intergenic
1176179273 20:63741883-63741905 CGCACCAGGGCCTCCTTCCAGGG - Exonic
1179476620 21:41650693-41650715 CGCATCTGTGCCTCCTCCAAGGG + Intergenic
1179834315 21:44019382-44019404 CACCTCAGTGCCTGCCTCTGTGG + Intronic
1179876542 21:44271802-44271824 GGCCTCAGTGCCCGCTTCCATGG + Intergenic
1183356558 22:37362882-37362904 TGCCTCACTGCTTCCTTCCAAGG - Intergenic
1183830299 22:40415298-40415320 CGCCTCAGTGCCACCTGCACTGG + Intronic
1183931801 22:41239717-41239739 CCCCTCAGAGCCTCCTCCTTTGG + Intronic
1184685898 22:46096195-46096217 GGCCTCAGTGCAGCCTCCTAAGG + Intronic
949943543 3:9172847-9172869 CGCACCAGGGCCTCCTTCCAGGG - Intronic
950547036 3:13644426-13644448 GGCCTCAGAGCCTCCTCCAAAGG - Intergenic
950972330 3:17201713-17201735 CCCCTCACTTCCTCCTTCTCTGG + Intronic
951300782 3:20994189-20994211 CAGCTCAGTTCCTCCTTTTAAGG - Intergenic
954526549 3:51276971-51276993 AGCCTCAGTGCATCTTTCTCTGG - Intronic
954875518 3:53800587-53800609 CCCCTCACTGCCTGCTTCTGAGG + Intronic
957577987 3:82033808-82033830 TGTCTCAGTGGCTCTTTCTACGG + Intergenic
959743845 3:109753480-109753502 CTTCTCAGGGTCTCCTTCTAGGG - Intergenic
960973994 3:123157951-123157973 TGCCTCAGGGCCTCCCTCTAAGG - Intronic
961321188 3:126077801-126077823 CTCCTCCGTGCTTCCTTCTCAGG + Intronic
963239893 3:142992577-142992599 CGCCTATGTGTCTCCTGCTAGGG + Intronic
963779665 3:149474820-149474842 CTCCTCACTGCCTCCTTCACGGG - Exonic
968573763 4:1355539-1355561 CCCCCCCGTGACTCCTTCTAGGG + Intronic
969112334 4:4851813-4851835 GGCCTCAGTGTCCCTTTCTATGG + Intergenic
969306711 4:6330027-6330049 AGCCTCAGTGCCTCGTGCTGTGG - Intronic
973806023 4:54526988-54527010 AGCCTCAGTACCTTCATCTATGG - Intergenic
984691757 4:182734155-182734177 CTCCTCAGTGATTCCTTCTTTGG - Intronic
985220699 4:187701032-187701054 TGCCTCAGTTCCTGCTTTTAAGG - Intergenic
986991431 5:13557369-13557391 CGCCTCAGTGCTTCCCTTCAGGG + Intergenic
989621687 5:43390573-43390595 GACCTCAGTGCCTGCTTCTCAGG - Intronic
989727420 5:44603606-44603628 CGCCACAGAGCCTCCTTCAAAGG - Intergenic
993057453 5:82998350-82998372 CCACTCACTGCCTCCTTTTAGGG + Intergenic
995508574 5:112885222-112885244 CTCCTCAGTGCCTTCTCCTTGGG - Intronic
995518218 5:112975086-112975108 TGTCTCAGTGCCTGCTTCTTAGG + Intergenic
997416670 5:133733926-133733948 CGCCTCAGTGCCTCCCCATGTGG + Intergenic
1002046509 5:176544261-176544283 CACCCCAGAGCCTCCTTCCAGGG - Intronic
1006556946 6:34875256-34875278 CTCCTTAGTGCCTCTTTCAAAGG + Exonic
1006683719 6:35815072-35815094 CGCCTCAGTGCCTCCTTCTAGGG - Intronic
1007254030 6:40516146-40516168 GGTCTCAGAGCCTGCTTCTAGGG + Intronic
1007800648 6:44389466-44389488 CGCCTAAGTGCATGCATCTATGG + Intronic
1008622757 6:53287767-53287789 GGCCGGAGTGCCTCCTTCTGAGG + Intronic
1012509894 6:99991252-99991274 AGCCTCAGTGCATCCTCCTCAGG + Intronic
1015002792 6:128240122-128240144 CTCCTCATTTCCTCCGTCTAGGG - Exonic
1017117444 6:150991851-150991873 CGCCTCAGTGCCATCTTCTCAGG - Intronic
1018429884 6:163714066-163714088 CCCCTCTGCGCCTCCCTCTAAGG - Intergenic
1022090619 7:27105784-27105806 GGCTCCAGTGCCTGCTTCTAAGG + Intergenic
1024396051 7:48868131-48868153 AGCATCAGTGTCTCCTTCTGAGG - Intergenic
1026593018 7:71712593-71712615 GTCCTCACTGCCTCCTTTTAGGG - Exonic
1027930509 7:84528113-84528135 CACCTTAGTTCATCCTTCTAAGG + Intergenic
1028158077 7:87454881-87454903 CTCCTCTGTGCCTCCTTAGAAGG - Intronic
1030782790 7:113622915-113622937 CACCTCAGTTCCTCCGTTTAAGG - Intergenic
1032010349 7:128342885-128342907 CACCTCAGTCCGTCCTTCTCTGG + Intronic
1034828897 7:154291781-154291803 CACCTCTGTGCAACCTTCTAAGG - Intronic
1035029486 7:155848248-155848270 GGCCTCAGGGCCTCCTGCCAGGG - Intergenic
1037377588 8:18248721-18248743 TCCCTCAATGCCTCCTTCTCTGG - Intergenic
1039376668 8:37041466-37041488 GCCTTCTGTGCCTCCTTCTATGG + Intergenic
1039472133 8:37820108-37820130 AGCCTCAGTGTCTGCTTTTAAGG + Intronic
1040786321 8:51168545-51168567 TGCCTCAGTGCCTACTCCTCAGG + Intergenic
1042998180 8:74724376-74724398 CCTCTAAGTGCCTCCTGCTATGG + Intronic
1047527267 8:125644201-125644223 CTCCTCAGTGCATCCTTCTTGGG + Intergenic
1047836872 8:128703420-128703442 CTCATCAATGCCTCCTGCTATGG - Intergenic
1048362699 8:133711851-133711873 TGCCTCAGTGCTTCCCTCCAGGG - Intergenic
1049303374 8:141883662-141883684 CGGCTGAGTGCCACCTTCTAGGG + Intergenic
1050176173 9:2871503-2871525 CGCTTATGTGACTCCTTCTACGG - Intergenic
1050990133 9:12139730-12139752 CAGCTCAGTTCCTCCTTTTAAGG + Intergenic
1053124223 9:35566577-35566599 TGCCTCTGTGCCTCCTTCCAGGG + Intergenic
1055360725 9:75487956-75487978 AGTCTCAGTGTCTCCTTATATGG - Intergenic
1057509850 9:95669256-95669278 CTCCTCAGGGTCTCCTTCCAGGG - Intergenic
1057929501 9:99181328-99181350 TGCCTCAGTGCCTCATGCTGAGG + Intergenic
1058187251 9:101869489-101869511 CTCCTCAGTCTCTGCTTCTAGGG + Intergenic
1060806932 9:126583538-126583560 AGCCTCAGTGCCTCCCTGCATGG - Intergenic
1061922550 9:133789978-133790000 AGGCTCAGTGTCTCCTTCCAAGG + Intronic
1190011656 X:46790465-46790487 CGTCTCAGTGTCTGCTTCTTAGG - Intergenic
1193467877 X:81869205-81869227 CTGCACAGAGCCTCCTTCTAAGG + Intergenic
1198418901 X:136449170-136449192 CTCCTCAGAGTCTCCTTCTCTGG - Intergenic