ID: 1006688889

View in Genome Browser
Species Human (GRCh38)
Location 6:35862287-35862309
Sequence GACCCTGATGGTGGCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006688889_1006688893 -4 Left 1006688889 6:35862287-35862309 CCACTAATGCCACCATCAGGGTC 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1006688893 6:35862306-35862328 GGTCCAAAGACTGGCTCAGCTGG 0: 1
1: 0
2: 5
3: 34
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006688889 Original CRISPR GACCCTGATGGTGGCATTAG TGG (reversed) Intronic
903077244 1:20780813-20780835 GTTCCTGATGGTGGCAGGAGGGG - Intronic
905222018 1:36454593-36454615 GGCCCTCATGATGGGATTAGTGG + Intergenic
906462214 1:46043503-46043525 GGCCGGGATGGGGGCATTAGAGG - Exonic
910439114 1:87234034-87234056 AACCCTGATGGTGGAAGTACAGG - Intergenic
916383775 1:164244101-164244123 GACCCTCATGATGAAATTAGTGG + Intergenic
918318896 1:183346238-183346260 GACCCTGAAGGTGAGATCAGGGG - Intronic
920764884 1:208822886-208822908 GACCATGATGGTGGCTCTTGTGG + Intergenic
920792147 1:209103599-209103621 GTGCCTGACCGTGGCATTAGTGG + Intergenic
921443750 1:215220347-215220369 GTTCCTGGTGGTGGCAGTAGCGG - Intronic
922972432 1:229754104-229754126 GCCCCTGCAGGTGGCATTTGGGG - Intergenic
1063422132 10:5921438-5921460 CTCCCTAAAGGTGGCATTAGAGG + Exonic
1067835965 10:49641977-49641999 AGCCCTGAGGCTGGCATTAGAGG - Intronic
1068219291 10:54023169-54023191 GACCCTGATGCTGGAATAAATGG - Exonic
1069907143 10:71738621-71738643 GACCCTGATGCTGGCAGCAATGG + Intronic
1071524832 10:86352585-86352607 GGCCCTCATGATGGGATTAGTGG - Intronic
1072482262 10:95820612-95820634 GACCTTGAAGGTGACATTTGAGG - Intronic
1075420546 10:122297385-122297407 GACCCTTATGGTGCCACCAGAGG - Intronic
1076851891 10:133097316-133097338 GACCCTGACGGAGGCCTGAGTGG - Intronic
1078762108 11:14259766-14259788 GACCTTTATGGTGGTAATAGTGG - Intronic
1084654709 11:70508348-70508370 AGCCCTGATGGTGGCCTTAGGGG - Intronic
1085453005 11:76648204-76648226 ATCCCTGGTGGTGGCATGAGGGG - Intergenic
1085773911 11:79348599-79348621 GACACTCATGATGGTATTAGTGG + Intronic
1088223965 11:107598738-107598760 GTGCCTGGTGGTGGCAGTAGAGG + Intronic
1091833130 12:3564345-3564367 GACCCTGATGGATGCACTGGAGG + Intronic
1092278629 12:7081997-7082019 GACCCTGATGATGGCCCCAGAGG + Intronic
1092900808 12:13057878-13057900 GACCCTGATGGTGGTGGTGGTGG + Intronic
1092965399 12:13636514-13636536 GACTGTGATGATGGCAATAGAGG + Intronic
1095509666 12:42936827-42936849 GATACTGGTGGTGGCATTAAAGG + Intergenic
1095655934 12:44668824-44668846 GACACTGATGGTGGCACTAGTGG - Intronic
1097066445 12:56324036-56324058 TACCCTGATGGTAGCAAAAGTGG - Exonic
1101576489 12:106001912-106001934 GACTGAGATGGTGGCATTTGAGG + Intergenic
1101838431 12:108311084-108311106 GACCCTGATGGTGGAATTGAAGG - Intronic
1103735707 12:123059502-123059524 CACCCTTCTGGGGGCATTAGTGG - Intronic
1106664078 13:31833369-31833391 GCCCCTCATGGTGAAATTAGTGG + Intergenic
1108436503 13:50406180-50406202 GGCCCTCATGGTGGGATTAGTGG + Intronic
1108565053 13:51688234-51688256 GATCATGATGGAGGCATTAGTGG + Intronic
1109370207 13:61413371-61413393 GACCCAGATGTAGGCATTAATGG - Exonic
1110120496 13:71874521-71874543 TTTCCTGATGGTGGGATTAGTGG + Intergenic
1110413270 13:75226161-75226183 TATCCTGATGGCGGCAGTAGTGG - Intergenic
1111890823 13:94080757-94080779 GGCCATCATGGTGGGATTAGTGG - Intronic
1112296411 13:98191087-98191109 GACACTGCTGGAGGCATTAAGGG + Intronic
1112992587 13:105532163-105532185 GACCATGATGATGGTAATAGGGG + Intergenic
1113361548 13:109635916-109635938 GACACTGAGGGTTGCATTATGGG + Intergenic
1113708598 13:112449620-112449642 GACCCTGGTGGTGGCAAAGGCGG - Intergenic
1114612779 14:24053218-24053240 GAGCCTGAGTGTGGCATTGGTGG - Intronic
1117497439 14:56319643-56319665 GAAGCTGAGGGTGGCATTTGGGG - Intergenic
1117950116 14:61074514-61074536 GACCCTCATAATGGGATTAGTGG - Intronic
1120256280 14:82123375-82123397 CAACCTGATGGTTGCATCAGAGG + Intergenic
1120392391 14:83924886-83924908 GTCCCCCATGGTGGCAGTAGTGG - Intergenic
1121625512 14:95383090-95383112 GCCCCTGATGGTGACTTTGGAGG + Intergenic
1126268712 15:46787068-46787090 GACCCTGATGGTGGCAATGTGGG + Intergenic
1128110327 15:65072025-65072047 GTCCTTGCTGGTGGCCTTAGTGG - Intronic
1130020419 15:80226103-80226125 TACCCTGATGGTGGAGTGAGAGG - Intergenic
1133241181 16:4415648-4415670 GACCCTGATGGGGTCACTTGAGG + Intronic
1137338281 16:47572656-47572678 AACTCTGATGGTGGCAGTAGGGG + Intronic
1137526116 16:49237785-49237807 GACCCTCATGATGGGATTAGTGG - Intergenic
1137813646 16:51377103-51377125 GACCAAGATGTTGTCATTAGAGG - Intergenic
1138927800 16:61612901-61612923 AACCCTGATAATGGGATTAGTGG - Intergenic
1139099512 16:63748547-63748569 GGCAATGATGATGGCATTAGTGG - Intergenic
1140141191 16:72259475-72259497 AGCCCAGATGGTGGCATTTGGGG + Intergenic
1140667853 16:77244145-77244167 GACATTGATGTTGGCATGAGGGG - Intergenic
1141314975 16:82953400-82953422 GACCCTGATGGTGGCAATGAAGG + Intronic
1141964460 16:87432535-87432557 GAACCTGAGGGTGCCCTTAGGGG - Intronic
1142022770 16:87794570-87794592 GAACCTGAAGGTGGGATCAGAGG - Intergenic
1144955693 17:19017819-19017841 CACCCTGATGGTGGCATGGGAGG + Intronic
1147437771 17:40428202-40428224 GGTAATGATGGTGGCATTAGAGG + Intergenic
1148238529 17:45984689-45984711 GATCCTCATGCTGGCATTGGAGG + Intronic
1151370109 17:73642471-73642493 GACCCTGATGCTGGCAGAATAGG - Intronic
1151969030 17:77447984-77448006 GACACTGATGGTGGGATCTGTGG + Intronic
1156034351 18:32750092-32750114 AACCCTCATGATGGAATTAGCGG - Intronic
1157412287 18:47473211-47473233 GGCCCTCATGATGGGATTAGTGG + Intergenic
1160243304 18:77137844-77137866 GACCCTGAGGGTGTCTTTCGAGG + Intergenic
1162765315 19:12915793-12915815 GTCCCTGCTCGTGGCATTCGGGG - Intronic
1163689308 19:18730156-18730178 GGCCCTGCTGGTGGCGTTGGTGG + Intronic
1164593594 19:29519539-29519561 GACCCTGATGGCAGCATAGGGGG - Intergenic
1164908364 19:31985700-31985722 GACAGTGATGGTGGCAGGAGTGG + Intergenic
1164961495 19:32434887-32434909 GGCCCTCATGATGGGATTAGTGG - Intronic
1167586205 19:50377121-50377143 GCCCATGATGGGGGCTTTAGGGG + Intronic
1168071066 19:53952116-53952138 GACCCTGATGGAGGCTTGGGAGG + Intergenic
1168289716 19:55351714-55351736 GACTGTGAGGCTGGCATTAGGGG + Intronic
1168454490 19:56495735-56495757 GTCCCTGAAGGTGGCAACAGAGG + Intergenic
929464158 2:42129708-42129730 GACACTGATGGTGGCCTCAGGGG + Intergenic
932036510 2:68252068-68252090 GACCCGGACGGCGGCAGTAGGGG + Intronic
935588573 2:104824297-104824319 GATGGTGATGGTGGCAGTAGTGG + Intergenic
938297940 2:130190097-130190119 TGCCCTGATGGTGCCATCAGCGG - Intronic
940006894 2:149016408-149016430 GACCCAGGTGGTGGCAGCAGGGG + Intronic
941805777 2:169711005-169711027 GTCCTAGATGGTGGCATTATGGG - Intronic
944344551 2:198646348-198646370 GACACTGAAGGAAGCATTAGTGG + Intergenic
1170126041 20:12965331-12965353 GACCCTGATGCAGGGATTTGAGG + Intergenic
1174140248 20:48408119-48408141 GAGCGTGATGTTGGCATTTGGGG - Intergenic
1175405628 20:58724227-58724249 GACCCTGATGCTGGAATTGTCGG + Intergenic
1181920824 22:26319225-26319247 GACCCTGCAGGTGGCAGTGGAGG - Intronic
1182739099 22:32553965-32553987 GACCGTGGTGGTGGCAGTGGAGG - Intronic
1183651466 22:39156591-39156613 GAGCTTGATGGTGGCAGAAGAGG + Intergenic
1185401749 22:50622490-50622512 GCCCCTGATGCTGGCATAAGGGG - Intergenic
949980047 3:9496763-9496785 CACTCTGGTGGTAGCATTAGGGG - Intergenic
951403731 3:22268204-22268226 CACTCTGATGCTGTCATTAGGGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
954806766 3:53225146-53225168 GACCCTCAGGATGGCATGAGAGG - Intronic
954932304 3:54294832-54294854 GCCACTGCTGGTGGCCTTAGTGG + Intronic
965569968 3:170162576-170162598 GATCATGATGGTGATATTAGAGG - Intronic
966161058 3:176968757-176968779 AGCTCTGATGGTGGCATGAGAGG - Intergenic
971139384 4:23907192-23907214 GATGGTGATGGTGGCAGTAGGGG - Intergenic
972678975 4:41287437-41287459 GACTCTGTTGGTGGCATTTCTGG - Intergenic
977060920 4:92256157-92256179 GACCCCCATGGTGGCAGCAGTGG + Intergenic
977209018 4:94196228-94196250 AACCCAGATGGTGGCCTTTGGGG + Intergenic
977974282 4:103245855-103245877 GACCCTGGTAGTGTCATCAGGGG - Intergenic
979410928 4:120378623-120378645 TACCTTTAAGGTGGCATTAGAGG + Intergenic
979832755 4:125320747-125320769 GACCCTGATGCAGACATTAATGG + Exonic
982677439 4:158392058-158392080 GACCCTGGTGATGGAATTATAGG - Intronic
984447902 4:179860505-179860527 GACACTTATGGTGGCATTTAGGG - Intergenic
985752000 5:1686110-1686132 GACTCTGACGGTGACATAAGGGG + Intergenic
986440062 5:7773009-7773031 GATCATGATGGTGGCCTTGGTGG + Exonic
987112823 5:14702650-14702672 TGCCCTGATGGTGCCATCAGGGG + Intergenic
987274378 5:16346559-16346581 TCTCCTGATGGTGGCATAAGAGG + Intergenic
987522484 5:19004874-19004896 GACCCTGATGTTGGCATAGAAGG + Intergenic
990272564 5:54159346-54159368 CACCCTGAAGATGGCATCAGAGG - Intronic
992704966 5:79381119-79381141 GACCCTGATGGTGGTACCAGTGG - Intronic
993634822 5:90331309-90331331 GGCCCTGGTGGTGGCAGCAGTGG + Intergenic
997423182 5:133785400-133785422 GAGCCTGATGGGGGCAGTAAAGG - Intergenic
998153358 5:139769756-139769778 GACACTGATGGTGGCAGTGGGGG + Intergenic
998403363 5:141859731-141859753 GACTATGATGGTGGCAATGGGGG - Intronic
999436380 5:151566689-151566711 GACCCTGATGCTGGTTTTAATGG - Exonic
1004191326 6:13466365-13466387 AACCCTGATGGAAGAATTAGTGG - Intronic
1005158521 6:22835248-22835270 GGCCCTGGTGGTGGCAGCAGTGG - Intergenic
1005671359 6:28109242-28109264 GGCCCTCATGGTGGTGTTAGTGG + Intergenic
1005946948 6:30602223-30602245 GGCCCTGGCGGTGGCATCAGTGG - Exonic
1006353366 6:33538052-33538074 GACCCTGAGAGTGGCAGGAGAGG + Intergenic
1006688889 6:35862287-35862309 GACCCTGATGGTGGCATTAGTGG - Intronic
1009504689 6:64461506-64461528 CAGTCTGGTGGTGGCATTAGTGG + Intronic
1013111971 6:107071246-107071268 GACACTGATGCTGGCAATACTGG + Intronic
1014098371 6:117483244-117483266 GACCCCGAGGGTCGCCTTAGGGG + Intronic
1015140709 6:129928292-129928314 GAGCCTGAAGGTGGCATACGTGG + Intergenic
1017509409 6:155100523-155100545 GACAGTGATGGTGGCAGTGGTGG - Intronic
1018103742 6:160464275-160464297 AACCCTGATGGTGACATCAATGG - Intergenic
1018112040 6:160545502-160545524 AACCCTGATGGTGACATCAATGG - Exonic
1019871079 7:3762283-3762305 GGTCCTGATGATGGCATTTGTGG + Intronic
1020157413 7:5737610-5737632 GACACTGTTGGAGCCATTAGTGG - Intronic
1020914427 7:14174686-14174708 TACCGTGATGGTGGAAATAGTGG - Intronic
1021599842 7:22354666-22354688 GGCCCTCATGATGGGATTAGTGG + Intronic
1024644833 7:51362445-51362467 GATGATGATGGTGGCAGTAGTGG - Intergenic
1027150314 7:75728838-75728860 GACCCTGATGGTGCCATATCAGG + Intronic
1028239056 7:88397395-88397417 GGCCTTTATGATGGCATTAGTGG + Intergenic
1029921956 7:104274645-104274667 GGCCCTCATGATGGGATTAGTGG - Intergenic
1030114196 7:106050683-106050705 GGGGCTGATGGTGGCATTACGGG - Intergenic
1031694792 7:124836891-124836913 GACACTGATTTAGGCATTAGTGG - Intronic
1032188558 7:129749014-129749036 GTCTCTGATGGTGGCACCAGGGG - Intronic
1034357536 7:150463979-150464001 GGCGCTGGTGGTGGCAGTAGTGG + Intronic
1035846877 8:2874926-2874948 TCCCCTGGTGGTGACATTAGTGG - Intergenic
1035955337 8:4071556-4071578 GACACAGATGTTGGAATTAGCGG - Intronic
1037738196 8:21583376-21583398 AACCCTCAAGGTGACATTAGGGG + Intergenic
1038059979 8:23902070-23902092 GACCCTCATGGTGGGATGAGTGG + Intergenic
1038225473 8:25653676-25653698 GACCCTAGTGGTGGCAGTGGTGG + Intergenic
1039101972 8:33950972-33950994 GGCCCTGGTGGTGGCAGCAGTGG + Intergenic
1042649386 8:71023482-71023504 GGCCCTAGTGGTGGCAGTAGTGG + Intergenic
1045181806 8:99792338-99792360 GACCCAGATGTTGGCATTATCGG + Intronic
1046806082 8:118480511-118480533 GACCCTGTTGTTTGCATTACTGG - Intronic
1048737574 8:137518798-137518820 GGCCCTGATGGTGGATGTAGAGG - Intergenic
1048871527 8:138803203-138803225 GGCCCTGGTGGTGGGATCAGTGG - Intronic
1049324023 8:142012493-142012515 GACTGTGATGATGGCAGTAGTGG - Intergenic
1050083728 9:1942125-1942147 GACACTGAAGGTGGCATTTAGGG + Intergenic
1056874132 9:90311728-90311750 GAAACTGAGGGTGGCAGTAGGGG - Intergenic
1057797003 9:98164939-98164961 GACCCTGGTGGTGGTGGTAGTGG - Intronic
1058452844 9:105113216-105113238 GACCTAGATGGTGGCATAGGAGG + Intergenic
1059591572 9:115668303-115668325 GACCCTGGTAGTGTCATCAGGGG - Intergenic
1060301678 9:122377817-122377839 GCCCCTGATGGGGGAATGAGGGG - Intronic
1060422142 9:123476894-123476916 GACCCAGACGGTAGCATAAGAGG + Intronic
1060775970 9:126374787-126374809 GTCCCTGATGGCAGCAATAGCGG + Intronic
1061928335 9:133818728-133818750 GACCCAGATGTTGCAATTAGTGG - Intronic
1190571388 X:51786229-51786251 GACACAGATGTTGGCATTATTGG - Intergenic
1190731288 X:53227602-53227624 GACCGTGATGGTGGTAGTGGTGG + Intergenic
1190862692 X:54358901-54358923 GGCCCTGATGGTGGCAGGTGGGG + Intergenic
1192025132 X:67442093-67442115 GTACCTCATGTTGGCATTAGTGG + Intergenic
1192491408 X:71579511-71579533 GATGCTGGTGGTGGCATTGGAGG + Intronic
1194865027 X:99054719-99054741 GACCCTAATGATGGGATTAGTGG - Intergenic
1195406035 X:104514415-104514437 GGCCTTCATGGTGGAATTAGTGG - Intergenic
1195968542 X:110450885-110450907 GAGTCTGAGGCTGGCATTAGGGG - Exonic
1197594705 X:128451300-128451322 GACCCTGGTGGTGGCAGGTGGGG + Intergenic