ID: 1006694695

View in Genome Browser
Species Human (GRCh38)
Location 6:35921006-35921028
Sequence GCCTCCGCCACGAGGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006694695_1006694707 27 Left 1006694695 6:35921006-35921028 CCATTGCCCCTCGTGGCGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 121
Right 1006694707 6:35921056-35921078 TGGTGAGACCGGTAATCGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
1006694695_1006694704 16 Left 1006694695 6:35921006-35921028 CCATTGCCCCTCGTGGCGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 121
Right 1006694704 6:35921045-35921067 TTTCCGCTCCATGGTGAGACCGG 0: 1
1: 0
2: 1
3: 164
4: 577
1006694695_1006694702 7 Left 1006694695 6:35921006-35921028 CCATTGCCCCTCGTGGCGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 121
Right 1006694702 6:35921036-35921058 CCGCTCACCTTTCCGCTCCATGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006694695 Original CRISPR GCCTCCGCCACGAGGGGCAA TGG (reversed) Intronic
900205023 1:1427947-1427969 GCCCCCGCCACGGAGGGCAGGGG + Intergenic
900565531 1:3330078-3330100 CCCTCCGCCAAGAGGGGTTAAGG + Intronic
900706893 1:4086589-4086611 GCCTCCACCAGAAGGGGCCAAGG - Intergenic
909536497 1:76741909-76741931 GCCTCACCCAGGAGGTGCAAGGG - Intergenic
918684323 1:187396697-187396719 GCCTCACCCAGGAAGGGCAAGGG + Intergenic
919805223 1:201377489-201377511 GCCTCCACCAGGAGGGGCCATGG + Intronic
923232431 1:231999602-231999624 CCCTGCCCCACCAGGGGCAAGGG + Intronic
924706545 1:246507168-246507190 GCAACCGCCAAGAGGGGAAACGG - Exonic
1066049168 10:31619166-31619188 GCCCCACCCATGAGGGGCAAGGG - Intergenic
1068940707 10:62678154-62678176 GCCTCACTCACGAGGCGCAAGGG - Intergenic
1070016907 10:72542717-72542739 CCCTCCGCCAGCAAGGGCAAAGG + Intronic
1070190676 10:74109033-74109055 GCCTCCACCACCAGAGGAAAAGG + Exonic
1076449262 10:130545046-130545068 CCCTCCACCACCACGGGCAAAGG - Intergenic
1076546396 10:131248534-131248556 GCCTCCCCCACGCAGGCCAATGG + Intronic
1077321917 11:1946605-1946627 GCCTCCTCCAAGAGGGCCACTGG - Intergenic
1078624441 11:12941069-12941091 GCCTCCCCCAGGAGAGGCCAGGG - Intronic
1082002295 11:47400027-47400049 GCCTCAGCGACGAGCGGCAGCGG - Intergenic
1084741931 11:71145770-71145792 GCCCCAGCCACGATGGGGAAGGG - Intronic
1084809424 11:71603375-71603397 GCTCCAGCCACGAGGGGCACCGG - Intergenic
1202804933 11_KI270721v1_random:1918-1940 GCCTCCTCCAAGAGGGCCACTGG - Intergenic
1091712113 12:2749465-2749487 GCCTACGCCACCAGGGCCCAGGG + Intergenic
1093561979 12:20552541-20552563 GCGTCCCCCAGGACGGGCAAGGG + Intronic
1095128274 12:38508052-38508074 GCCTCACCCAGGAAGGGCAAGGG + Intergenic
1103769787 12:123312626-123312648 ACCTCCGCCACCAGGTTCAAAGG - Intronic
1105745604 13:23375068-23375090 GGCTCCGCCACGCGGAGGAACGG - Intronic
1106037082 13:26052505-26052527 GCCTCCACCACAAGGTGGAACGG + Intergenic
1110381212 13:74853553-74853575 GCCTCTGCCACGTAGGACAATGG - Intergenic
1115912242 14:38269226-38269248 GCCTCACCCAGGAAGGGCAAGGG - Intergenic
1117170003 14:53084825-53084847 GCCTCACCCAGGAGGCGCAAGGG + Intronic
1119705820 14:76781982-76782004 GCCCCCACCTCCAGGGGCAAAGG - Exonic
1121114579 14:91334795-91334817 GCATCTGCCACCGGGGGCAAGGG + Intronic
1128639872 15:69328491-69328513 GCCTCCTCCAGGAGGGACACGGG - Intronic
1133177585 16:4026934-4026956 TCATCTGCCACGAGGTGCAAAGG - Intronic
1135182551 16:20288359-20288381 GCCTTCGCCACGTTAGGCAAGGG - Intergenic
1138692925 16:58785793-58785815 GCCTCAGCCAGGAAGCGCAAGGG - Intergenic
1141967598 16:87457086-87457108 GCCACACCCACGAGGGGCAGGGG + Intronic
1142137045 16:88456215-88456237 GCCCCGGCCAGGAGGGGGAAGGG + Intronic
1143390053 17:6555129-6555151 GCCTCCCTCAGGAGGGGAAAAGG + Intronic
1144724060 17:17492648-17492670 ACCTCCTCCTCGAGAGGCAACGG - Exonic
1146161826 17:30564169-30564191 GCCACCCCAAAGAGGGGCAAAGG + Intergenic
1146255383 17:31389240-31389262 GCCTCCCCCACCAGTGGCACTGG - Intergenic
1151441312 17:74131006-74131028 GCCTCCGCCACCAGATGCAAAGG - Intergenic
1152436274 17:80278302-80278324 GCCTCCGCCTCTAGGGGCTTGGG + Intronic
1153221496 18:2866144-2866166 GCCTCACCCAGGAAGGGCAAGGG - Intronic
1154014876 18:10607495-10607517 GCTCCCTCCACGAAGGGCAAAGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1154190616 18:12228083-12228105 GCTCCCTCCACGAAGGGCAAAGG - Intergenic
1155363801 18:25030665-25030687 GCCTCTGCCTCGAGTGGCCATGG + Intergenic
1161408187 19:4102092-4102114 CCCCCTGCCACGAGGGGCAGAGG + Intronic
1161557807 19:4954443-4954465 GCGTCCCCCAGGACGGGCAAGGG + Exonic
1162725774 19:12689108-12689130 GCCTCCGCCCCGTGGGCCTAGGG - Exonic
1163630979 19:18417764-18417786 GCCTCCTCCCCGAGGGGCCTCGG - Intergenic
1164398639 19:27887841-27887863 GCCTCCTCCAGGAGGGACCATGG + Intergenic
1165333378 19:35153888-35153910 GCCGCCGCCACCAGGGGCTGGGG - Exonic
929849470 2:45570931-45570953 GCCCCAGCCATGAGGGGTAAGGG + Intronic
932719477 2:74128400-74128422 GCCACCGCCAGGAGGAGCCAAGG + Intergenic
934618159 2:95787982-95788004 GCCTGCGCCCAGAGGGACAAAGG - Intergenic
934642734 2:96036577-96036599 GCCTGCGCCCAGAGGGACAAAGG + Intronic
935098590 2:99970706-99970728 CCCTGCGTCACTAGGGGCAACGG - Intronic
935604768 2:104959560-104959582 GCCTCACCCAGGAAGGGCAAGGG - Intergenic
946563673 2:220940530-220940552 CCCTCCGCCAGAAAGGGCAAAGG - Intergenic
946582254 2:221142313-221142335 GCCTACGCCAAGAGGACCAAAGG + Intergenic
1173582879 20:44159833-44159855 GCCTCCGCTACGAGGGCGAGTGG - Exonic
1173914494 20:46696840-46696862 GCCTCAGACCCAAGGGGCAAGGG + Intergenic
1175017380 20:55806638-55806660 GCCTTGGGCATGAGGGGCAAGGG - Intergenic
1175945161 20:62555273-62555295 GCCCCCGACAGGTGGGGCAAGGG - Intronic
1176869792 21:14075451-14075473 GACTAAGCCACGAGGAGCAAAGG - Intergenic
1176869840 21:14075724-14075746 GCCTTCCCCACCAGGGTCAAAGG + Intergenic
1177281455 21:18987451-18987473 CCCTCCGCCAGCAAGGGCAAAGG - Intergenic
1182939513 22:34261936-34261958 CCCTCCCCCATGAGGGGCAGAGG - Intergenic
950527991 3:13535884-13535906 GGCTCAGCCAGGAGGGGCAGAGG - Intergenic
951042738 3:18005606-18005628 GCCTCACCCAGGAAGGGCAAGGG - Intronic
951319361 3:21226181-21226203 CCCTCCGCCAGCAAGGGCAAAGG - Intergenic
953264209 3:41370533-41370555 GCCTCACCCAGGAAGGGCAAGGG + Intronic
958618449 3:96526840-96526862 GCCTCACCCAGGAAGGGCAAGGG + Intergenic
964904757 3:161706963-161706985 GCCTCAGCCAGGAAGTGCAAGGG + Intergenic
965200765 3:165655322-165655344 GCCTCACCCAGGAAGGGCAAGGG + Intergenic
968235613 3:197028894-197028916 GCCTCCGCCAGGAGTGGGGAGGG - Intronic
969022508 4:4147658-4147680 GCTGCAGCCACGAGGGGCACTGG + Intergenic
970792022 4:19868774-19868796 GCCTCACCCGGGAGGGGCAAGGG - Intergenic
983949122 4:173619179-173619201 GCCTCACCCACGAAGTGCAAGGG - Intergenic
985491300 5:181372-181394 CCCTGCCCCACGAGGGGCATGGG - Intronic
987696620 5:21341622-21341644 GCCACCTCCCCGCGGGGCAAGGG + Intergenic
988755583 5:34244948-34244970 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
989820100 5:45786335-45786357 GCCTCCCCCAGGAAGTGCAAGGG + Intergenic
991743827 5:69710690-69710712 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
991753886 5:69844552-69844574 GCCACCTCCCCGCGGGGCAAGGG + Intergenic
991795399 5:70290422-70290444 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
991803511 5:70401307-70401329 GCCACCTCCCCGCGGGGCAAGGG + Intergenic
991823194 5:70585958-70585980 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
991833198 5:70719665-70719687 GCCACCTCCCCGCGGGGCAAGGG + Intergenic
991887766 5:71289941-71289963 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
998435874 5:142108658-142108680 GCCGCCGCCCCGAGGTGCACCGG - Exonic
999153719 5:149443077-149443099 GTCCCCGCCACCAGGGGCATGGG + Intergenic
1002673489 5:180889725-180889747 GCCTACGCCACCAGGGCCCAGGG + Intergenic
1005554219 6:26956721-26956743 GCCACCTCCCCGCGGGGCAAGGG - Intergenic
1006694695 6:35921006-35921028 GCCTCCGCCACGAGGGGCAATGG - Intronic
1006924511 6:37647161-37647183 GCATCCGCCAGGTGGGCCAAGGG - Exonic
1011559425 6:88599779-88599801 GCCTCCTCCACCAGAGGCACTGG + Intergenic
1013625755 6:111935225-111935247 GCCTCACCCACGAAGAGCAAGGG - Intergenic
1015046317 6:128780188-128780210 GCCTCACCCAGGATGGGCAAGGG - Intergenic
1017913303 6:158813533-158813555 TCCTCCTCCACGAGGGGCAGTGG - Intronic
1019005054 6:168789862-168789884 GCCCCTTGCACGAGGGGCAAAGG + Intergenic
1020693872 7:11391726-11391748 GCCTCCGCCACCAGGGCCCTGGG - Intronic
1021207807 7:17806984-17807006 GCCTCCGCCACCACGGGCCTGGG + Intronic
1023874095 7:44277670-44277692 GCCTCCCCCACAAGGCCCAAGGG + Intronic
1028609974 7:92700095-92700117 GCTTCAGCGAGGAGGGGCAAGGG + Intronic
1030449747 7:109693074-109693096 GCCTCACCCAGGAAGGGCAAGGG - Intergenic
1033373218 7:140731097-140731119 GCCTCCGCCCCCAGGTTCAAGGG + Intronic
1039447229 8:37642609-37642631 GCCACCGACACCAGGGCCAAGGG + Intergenic
1040098964 8:43480253-43480275 GCCTCAGCCAGGAAGTGCAAGGG + Intergenic
1040663711 8:49605069-49605091 CCCTCCACCAGGAAGGGCAAAGG - Intergenic
1046958921 8:120089228-120089250 GCCTGCGCCACAGTGGGCAATGG + Intronic
1048214080 8:132480296-132480318 GCGGCCGCGACGAGGGGCAGCGG - Exonic
1051296456 9:15601070-15601092 GCCTCCCCCAGGAGGCACAAGGG - Intronic
1057277529 9:93683956-93683978 GCCTCCACCCGGAGGGGCAGGGG + Intergenic
1057498475 9:95578445-95578467 GCATCCCACCCGAGGGGCAAGGG - Intergenic
1060804547 9:126566268-126566290 GCCTCCGACATCAGGGCCAATGG + Intergenic
1187374553 X:18740070-18740092 GCCTCACCCAGGAAGGGCAAGGG - Intronic
1190326429 X:49209750-49209772 ACCTCCTCCTCTAGGGGCAAGGG + Exonic
1192755192 X:74039874-74039896 GCCTCACCCACGAAGTGCAAGGG - Intergenic
1193789618 X:85801856-85801878 GCTTCCGCCATGAGTGGAAACGG - Intergenic
1197988295 X:132290414-132290436 GCCTCACCCAGGAAGGGCAAGGG - Intergenic
1201364733 Y:13191189-13191211 GCCTCCTCCTCTAGGGGCAGTGG + Intergenic
1201599544 Y:15713182-15713204 GCCTCCCCCAAGAAGTGCAAGGG + Intergenic