ID: 1006695749

View in Genome Browser
Species Human (GRCh38)
Location 6:35929218-35929240
Sequence CAGAGGTATAAAATGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006695744_1006695749 4 Left 1006695744 6:35929191-35929213 CCAGTCAGAGAAAACAGCATGGT No data
Right 1006695749 6:35929218-35929240 CAGAGGTATAAAATGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006695749 Original CRISPR CAGAGGTATAAAATGTAAGG GGG Intergenic
No off target data available for this crispr