ID: 1006709967

View in Genome Browser
Species Human (GRCh38)
Location 6:36059878-36059900
Sequence TGCATGGGCGATAAAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006709967 Original CRISPR TGCATGGGCGATAAAAGAGG AGG (reversed) Intronic
901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG + Intergenic
903290305 1:22308961-22308983 AGCATGGCTCATAAAAGAGGTGG + Intergenic
909876166 1:80806485-80806507 TGCTTGGCAGATAAAAGATGAGG - Intergenic
912956432 1:114156877-114156899 TACATGAGGGAGAAAAGAGGAGG + Intergenic
919400083 1:197103281-197103303 TGCATGTGCAACAAAAGAAGTGG - Exonic
1065780568 10:29162724-29162746 AGCAGAGGTGATAAAAGAGGAGG + Intergenic
1065972442 10:30816249-30816271 AGCAAGAGAGATAAAAGAGGAGG + Intergenic
1066745683 10:38603121-38603143 AGCATGGGCGAGAAGACAGGAGG + Intergenic
1069725415 10:70574413-70574435 TGCAAGGGCAATACATGAGGAGG - Intergenic
1070513341 10:77180831-77180853 TGAATAGGAAATAAAAGAGGTGG - Intronic
1085970234 11:81580618-81580640 TGAATGGCAGATACAAGAGGTGG - Intergenic
1096117103 12:49060954-49060976 GGCCTGGGCGGTAAATGAGGCGG - Intergenic
1097556162 12:61140084-61140106 TGCATGGGTGATAAAATAATGGG - Intergenic
1107677002 13:42807902-42807924 TGCATGGGATATCAAAGGGGAGG - Intergenic
1120546466 14:85818299-85818321 TGCATGGGAGGTAAGGGAGGAGG + Intergenic
1124203703 15:27699551-27699573 TACATGTGGGAGAAAAGAGGAGG + Intergenic
1129538930 15:76335850-76335872 TGGATGGGGGAAAAATGAGGGGG + Intergenic
1133384045 16:5354498-5354520 TGCTTGGGGGTTAAATGAGGTGG + Intergenic
1136995126 16:35183876-35183898 CTCATGGGCCATAAAAGAGCAGG + Intergenic
1137795109 16:51210635-51210657 AGCCTGGGAGTTAAAAGAGGAGG + Intergenic
1138041902 16:53680434-53680456 TCAATGGGCTATAAAAGAGTGGG + Intronic
1142527067 17:550689-550711 TACAAGAGAGATAAAAGAGGGGG + Intronic
1143323754 17:6084913-6084935 TGCGACGGGGATAAAAGAGGAGG - Intronic
1149654654 17:58303814-58303836 TACTTGGGGGATAAAAGGGGAGG - Intronic
1155428815 18:25734262-25734284 TGCAGGGGAGATGGAAGAGGAGG - Intergenic
1156677885 18:39552793-39552815 TTCCTGGGCAATAAAAGAGAAGG + Intergenic
1158075935 18:53529896-53529918 TGAATGGTGGATAAAAGAAGAGG - Intronic
1158392907 18:57058298-57058320 TGGATGGGCGGTAAAGGAGACGG - Intergenic
1161625663 19:5325104-5325126 AGAATGGGGGATCAAAGAGGTGG - Intronic
1167388773 19:49180721-49180743 TGGATGGGCGATTAAAGGGAAGG - Intronic
1167647368 19:50712989-50713011 TGCATGGGAGATACATGAAGAGG + Intronic
932886566 2:75554333-75554355 TGCCTTGGTGATCAAAGAGGGGG + Intronic
933967173 2:87439668-87439690 TGCAAGGGCGATAACACACGTGG + Intergenic
934188512 2:89765643-89765665 AGCATGGGCGAGAAGACAGGAGG - Intergenic
934308083 2:91842312-91842334 AGCATGGGCGAGAAGACAGGAGG + Intergenic
942599205 2:177622937-177622959 TGCATGGGCAATTACACAGGGGG - Intergenic
943896560 2:193369964-193369986 TGCATGGGTTATAAAAGACTAGG - Intergenic
944256941 2:197632659-197632681 GGAATGGGTGAGAAAAGAGGAGG + Intronic
1177929764 21:27266525-27266547 TGCATGGGTTATGAAAGAGCAGG + Intergenic
1178912462 21:36686552-36686574 TACATGGGCAATAAAAGTTGCGG + Intergenic
1180535165 22:16389395-16389417 AGCATGGGCGAGAAGACAGGAGG + Intergenic
1180658966 22:17449174-17449196 TAAATGGGGGATAAAAGAGGTGG - Intronic
950171005 3:10839109-10839131 GGAATGGGGGATAAGAGAGGAGG - Intronic
952401703 3:32969425-32969447 TGTATGGGCCCCAAAAGAGGTGG + Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955517691 3:59744055-59744077 GGCTGGGGAGATAAAAGAGGAGG + Intergenic
957173047 3:76764757-76764779 TGCATAGGAGATTAGAGAGGTGG - Intronic
962041073 3:131708026-131708048 TGAATGGGAGAGAAAAGAAGAGG - Intronic
962287906 3:134103802-134103824 TGCAGGGGAGATCAGAGAGGAGG - Intronic
964268897 3:154933510-154933532 TGCCTGGGCTATAAAATATGTGG - Intergenic
965847795 3:172985128-172985150 TGCATGGGGGATAAGGGAGGAGG - Intronic
970026845 4:11633113-11633135 TACATGGGGAATAAAAGATGAGG - Intergenic
972159121 4:36200553-36200575 TCCATGTGCTAGAAAAGAGGAGG - Intronic
973177297 4:47223315-47223337 TGTATGTGCGATGAAAGATGTGG + Intronic
977325834 4:95573313-95573335 TGCAGGGGCTATAAATGATGTGG + Intergenic
977823725 4:101505477-101505499 TGCATGGGGGATGAGAGAGGAGG + Intronic
978478103 4:109155281-109155303 AGCCTGGGGGATAACAGAGGAGG - Intronic
982173339 4:152682474-152682496 TCCATGGGCCATAAAAGAAGAGG + Intergenic
988257433 5:28839504-28839526 TGGTTGGGCAATAAAAGATGGGG - Intergenic
989487241 5:42005829-42005851 TGCTTGGGTGATAGAAGAGGAGG - Intergenic
996129206 5:119760730-119760752 AACATGGGAGATACAAGAGGAGG + Intergenic
996183220 5:120446208-120446230 TACATGGGTGATAGAAGAGCTGG + Intergenic
1000572712 5:162935364-162935386 GGCATGGGCAATAACAGTGGTGG + Intergenic
1001031088 5:168263436-168263458 GGGAGGGGGGATAAAAGAGGAGG + Intronic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1012444568 6:99294609-99294631 TTCATGGTCAAAAAAAGAGGGGG + Intronic
1019908519 7:4083342-4083364 TGCATGGGGGAAAAGAGTGGGGG - Intronic
1022222262 7:28325012-28325034 TGCATTGGAGGTAAAAGAAGTGG - Intronic
1024027964 7:45430310-45430332 TGCATAGGTGAGAAAAGTGGGGG - Intergenic
1032591532 7:133196573-133196595 TGCATGGGAGGTACAAGAGAGGG - Intergenic
1039257942 8:35739721-35739743 AGCATGGGCAATAAAAGAGATGG - Intronic
1043529618 8:81135071-81135093 TCCAGGGGAGACAAAAGAGGTGG - Intergenic
1046897402 8:119487745-119487767 GGGATGGGAGATAAAAGTGGAGG - Intergenic
1047623767 8:126635006-126635028 TTCATGGGAGATAAATGATGTGG - Intergenic
1048325068 8:133432731-133432753 AGCCTGGGCGAGATAAGAGGTGG - Intergenic
1187285189 X:17898067-17898089 TGCATGGAGGGTAAGAGAGGTGG - Intergenic
1190944574 X:55079136-55079158 TGCATGTGCTAAAAACGAGGAGG - Intergenic
1190945817 X:55093069-55093091 TGCATGTGCTAAAAACGAGGAGG - Intronic
1190964369 X:55284450-55284472 TGCATGTGCTAAAAACGAGGAGG - Intronic
1194508230 X:94759943-94759965 TGGAGGGGGCATAAAAGAGGCGG + Intergenic
1195353865 X:104019991-104020013 TGAATGGGCAATAAAGTAGGTGG + Intergenic
1197268247 X:124398844-124398866 TGCATGGGGGACAAAACAGTTGG - Intronic
1199028318 X:142965968-142965990 AGCGTGGGCTATAAAAGAAGTGG - Intergenic