ID: 1006711494

View in Genome Browser
Species Human (GRCh38)
Location 6:36076345-36076367
Sequence CTGACTAAAGGGCTGTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006711494 Original CRISPR CTGACTAAAGGGCTGTTCAA AGG (reversed) Intronic
901838160 1:11937452-11937474 CTGACCACCGGGCTGTGCAAAGG + Intronic
903229182 1:21911557-21911579 CTGGGTAAAGGGCTGTGCTATGG - Intronic
905641842 1:39595389-39595411 CTGACTCAAGGCCAGTTCAGTGG - Intergenic
917008507 1:170444154-170444176 TTGCCTCATGGGCTGTTCAAAGG + Intergenic
917438966 1:175049504-175049526 CTGAATAAAGGGCAGAGCAATGG - Intergenic
923992951 1:239459408-239459430 CTGTCTAAAGGAGTCTTCAAAGG + Intronic
1064620580 10:17212692-17212714 CTGTCTTAAGCCCTGTTCAAGGG + Intergenic
1066470427 10:35692571-35692593 CTGTCTAAAGGACTGTAAAAGGG - Intergenic
1069282550 10:66673205-66673227 CTGACTAAAGTGGTGCTAAATGG - Intronic
1074327957 10:112471200-112471222 CTGACTAAATACCTGTTTAAAGG + Intronic
1075745374 10:124723847-124723869 CTGAGTAAAAGTCTGTTCTAAGG - Intronic
1079572157 11:21956661-21956683 CTGGCTAAAGGTTTGTTAAAAGG - Intergenic
1081589281 11:44409691-44409713 CGGACCAAAGGCCAGTTCAAAGG - Intergenic
1085327016 11:75613924-75613946 GTGACTATATGGCTGTTCAAAGG - Intronic
1085524000 11:77153869-77153891 CTCAGTAAAGGGTTGTTGAATGG + Intronic
1089026799 11:115279176-115279198 CTGACTTATGGGTTGTTAAAGGG - Intronic
1095837041 12:46650237-46650259 CTGACCAAAGTGCTTTTCAGAGG - Intergenic
1096263567 12:50107284-50107306 TTGACTTGAGGGCTGTACAATGG + Intronic
1098030517 12:66248900-66248922 CTGAGAAAATGGCTGGTCAAGGG + Exonic
1103105476 12:118220835-118220857 CAGACTATAGAGCTGTTCTATGG - Intronic
1103341177 12:120221916-120221938 CAGAAGAAAGGGCAGTTCAATGG + Intronic
1105543614 13:21336380-21336402 CTGACCAAAGGATTCTTCAAAGG + Intergenic
1106572287 13:30937761-30937783 CTGACTAAGGGGCTCTTAAGTGG + Intronic
1116646001 14:47530065-47530087 CTGACTACACGTCTGTTCATAGG - Intronic
1118210932 14:63765075-63765097 CTGAGGAAGGGGCTGTTCTAAGG + Intergenic
1119632249 14:76243249-76243271 CTCACTCAAGGGCTGCTGAAAGG - Intronic
1125189449 15:36973284-36973306 GTCACAAAAGGGCTCTTCAAAGG + Intronic
1125410465 15:39400640-39400662 CTGACTAAAGTTTTGGTCAAGGG + Intergenic
1126105796 15:45146271-45146293 CAGAGTAAATGTCTGTTCAATGG - Intronic
1135668265 16:24353734-24353756 GTGACTAAATGGGTATTCAATGG + Intronic
1142538939 17:641954-641976 GTGACTGCAGGGCTGTTCCAAGG + Intronic
1151298028 17:73199961-73199983 CTGACTGATGGGATGTGCAAGGG - Exonic
1154886066 18:20291562-20291584 CTGTCTAAAGAAATGTTCAACGG - Intergenic
1155535390 18:26811334-26811356 CTGACTATTGGGTTTTTCAATGG - Intergenic
1159235324 18:65663878-65663900 CTGACTAAAGTTTTGTTCAAAGG + Intergenic
1162359067 19:10206718-10206740 CTGACTCAAGGGCTCTTTGAAGG - Intronic
1164486729 19:28663400-28663422 CTGTCTAGAGGTCTGTCCAACGG + Intergenic
928992520 2:37248964-37248986 CAGACTAAATGGCTATTCACAGG + Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
937553981 2:123131677-123131699 CTGCCTAAAGACCTGTTGAATGG + Intergenic
938728712 2:134129842-134129864 CGGGCTGAAGGGCTGCTCAACGG - Intronic
940176220 2:150880466-150880488 CTGACTAAAGTTTTGGTCAAAGG - Intergenic
941767833 2:169317547-169317569 CTAACTATAGGGTTGTTCCAGGG - Intronic
942717591 2:178910995-178911017 CTGCCTAAAGTGCTATTGAATGG - Intronic
946288415 2:218723488-218723510 CTGGCTCAAGGGGAGTTCAAGGG - Intronic
948644793 2:239397776-239397798 ATGAGTTAAGGTCTGTTCAAAGG + Intronic
1177782336 21:25634657-25634679 CTGACTAAAGTTTTGGTCAAAGG - Intergenic
1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG + Intronic
1181996144 22:26884216-26884238 CTGACTCTAGGGCTGTTCTGGGG + Intergenic
1182929239 22:34157247-34157269 CTCACTAAATGTCTGGTCAATGG - Intergenic
1184370596 22:44079548-44079570 CTGGCTAAAGGGCTGAGTAAGGG - Intronic
951489096 3:23248913-23248935 CTGATTTAAGAGCTATTCAAAGG + Intronic
951693307 3:25419482-25419504 CTGACTAAAGCTTTGGTCAAAGG + Intronic
951748910 3:26012101-26012123 CTGAATAAGGTGCTGTTAAATGG - Intergenic
953401691 3:42627839-42627861 CTGTTTAAAGAGCTGTGCAATGG - Intronic
956845516 3:73178678-73178700 CTGAAGAAAGGGCAGTTCATAGG - Intergenic
958866159 3:99503960-99503982 CTTACTATATGGTTGTTCAAAGG + Intergenic
968039200 3:195574172-195574194 CTGAGTAAAGGGCTCTTCTCAGG + Intronic
969803679 4:9589467-9589489 CTGACCACAGGGCTGTTTCATGG + Intergenic
971570816 4:28208518-28208540 CTGATTAAAGTGATGTTGAAAGG - Intergenic
974098977 4:57396154-57396176 CTGACTAAAGTACTTTTCTAAGG - Intergenic
981023988 4:140057411-140057433 CTGACCAAGGGGCTGTTCTTAGG - Intronic
983434951 4:167701347-167701369 CTGAATAAATGGCTATACAATGG + Intergenic
984351099 4:178594739-178594761 TTGTCTAAAGGGCTTTCCAATGG + Intergenic
985295724 4:188435406-188435428 TAGACTAAAGGGCAGTTCAGTGG + Intergenic
985706576 5:1405050-1405072 CAGACTACATGGCTGTTCAGAGG - Intronic
988240586 5:28602656-28602678 CTGACTAAAGGTTTACTCAAAGG + Intergenic
992406669 5:76464708-76464730 CTGAATAAAGAACTTTTCAATGG - Intronic
995804546 5:116036985-116037007 CTGAGAAAAGGGCTGCTCAGAGG - Intronic
1000437767 5:161234144-161234166 CTAACAAAATGGCTTTTCAATGG + Intergenic
1001120256 5:168974480-168974502 GTGACTGAAGGGGTTTTCAAGGG + Intronic
1005918189 6:30373019-30373041 CTCTCTAAAGGGCTGTTCTTGGG - Intergenic
1006711494 6:36076345-36076367 CTGACTAAAGGGCTGTTCAAAGG - Intronic
1007226570 6:40319725-40319747 CTGACTATAATGCTGTTCCAAGG - Intergenic
1008373404 6:50763006-50763028 CTGACTGAAGGGCTATTCATAGG - Intronic
1014947283 6:127514478-127514500 CAGACTGAAGGGCAGATCAAAGG + Intronic
1015254612 6:131163969-131163991 CTGACTAAAGTTTTGGTCAAAGG + Intronic
1016538224 6:145133266-145133288 CTGACTACACGTCTGTTCATAGG - Intergenic
1020548285 7:9563572-9563594 CTAACAAATGGGCTATTCAAAGG - Intergenic
1021484526 7:21152997-21153019 GTGATTAAAGGGCTATTCAGTGG + Intergenic
1023700796 7:42890263-42890285 CTAATGAAAGGGCTGTTAAATGG - Intergenic
1024519832 7:50295402-50295424 GTGAGCAAAGGGCTCTTCAAAGG + Intergenic
1028247006 7:88491327-88491349 CTGCCTAAAGAGATGTTCAAGGG - Intergenic
1030323312 7:108192626-108192648 CTTACTAAAGGGCTTTACTAAGG + Intronic
1031738412 7:125396648-125396670 CTGACTAGAAGCCTGTTCACCGG + Intergenic
1039337685 8:36610933-36610955 CTGACCAAAGTGCTCTTCAGGGG - Intergenic
1041081935 8:54222360-54222382 CAGACTAAAGGGAGGTTCAAGGG + Intergenic
1041110934 8:54481705-54481727 CTGCCTAAATTGCTGATCAATGG - Intergenic
1043305378 8:78787196-78787218 CTGACCAACTGGCTGTACAATGG - Intronic
1044449728 8:92320560-92320582 CTCACTCCAGGGATGTTCAAGGG + Intergenic
1045731381 8:105245858-105245880 CTGACAAAAGTTCTGTTCATGGG - Intronic
1048044301 8:130758843-130758865 CTGAGTCAAGGGCTGTCCCATGG - Intergenic
1048816960 8:138343219-138343241 CTGACCACAGAGCTGTTCAATGG + Intronic
1050130751 9:2409158-2409180 CTGACTTAAGGTCTCTCCAAGGG - Intergenic
1050153297 9:2639078-2639100 CTGACTAATATACTGTTCAAGGG - Intronic
1050991114 9:12153469-12153491 CTGACTAAAGGGCACTTGAAAGG - Intergenic
1187572330 X:20517826-20517848 CACATTATAGGGCTGTTCAAAGG - Intergenic
1194879379 X:99231899-99231921 CTGACTAAAGGTCATTTCAATGG + Intergenic
1199936551 X:152580029-152580051 CTGACTAAAGATTTGGTCAAAGG - Intergenic