ID: 1006714204

View in Genome Browser
Species Human (GRCh38)
Location 6:36104247-36104269
Sequence GCTTAGGTTTGCATCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006714195_1006714204 30 Left 1006714195 6:36104194-36104216 CCTAGGATGAATCCACAGTCTCA 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1006714204 6:36104247-36104269 GCTTAGGTTTGCATCTGCCCTGG No data
1006714201_1006714204 18 Left 1006714201 6:36104206-36104228 CCACAGTCTCATCAGGGGTGGGT 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006714204 6:36104247-36104269 GCTTAGGTTTGCATCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006714204 Original CRISPR GCTTAGGTTTGCATCTGCCC TGG Intronic
No off target data available for this crispr