ID: 1006716231

View in Genome Browser
Species Human (GRCh38)
Location 6:36122486-36122508
Sequence TCGGCCAGTCACCGGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006716225_1006716231 -4 Left 1006716225 6:36122467-36122489 CCTGCTACATCCCTGCCATTCGG No data
Right 1006716231 6:36122486-36122508 TCGGCCAGTCACCGGCTGCCAGG No data
1006716224_1006716231 -3 Left 1006716224 6:36122466-36122488 CCCTGCTACATCCCTGCCATTCG No data
Right 1006716231 6:36122486-36122508 TCGGCCAGTCACCGGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006716231 Original CRISPR TCGGCCAGTCACCGGCTGCC AGG Intergenic
No off target data available for this crispr